ID: 1080513256

View in Genome Browser
Species Human (GRCh38)
Location 11:32996397-32996419
Sequence CTACAGTAGCCAAAACAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080513256_1080513260 2 Left 1080513256 11:32996397-32996419 CCATATTGTTTTGGCTACTGTAG No data
Right 1080513260 11:32996422-32996444 CTGTAGTATAGTTTGAAGTTGGG 0: 199
1: 1154
2: 15403
3: 8886
4: 5634
1080513256_1080513259 1 Left 1080513256 11:32996397-32996419 CCATATTGTTTTGGCTACTGTAG No data
Right 1080513259 11:32996421-32996443 CCTGTAGTATAGTTTGAAGTTGG 0: 188
1: 797
2: 1153
3: 1041
4: 885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080513256 Original CRISPR CTACAGTAGCCAAAACAATA TGG (reversed) Intergenic
No off target data available for this crispr