ID: 1080513259

View in Genome Browser
Species Human (GRCh38)
Location 11:32996421-32996443
Sequence CCTGTAGTATAGTTTGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4064
Summary {0: 188, 1: 797, 2: 1153, 3: 1041, 4: 885}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080513256_1080513259 1 Left 1080513256 11:32996397-32996419 CCATATTGTTTTGGCTACTGTAG No data
Right 1080513259 11:32996421-32996443 CCTGTAGTATAGTTTGAAGTTGG 0: 188
1: 797
2: 1153
3: 1041
4: 885
1080513255_1080513259 7 Left 1080513255 11:32996391-32996413 CCAGTACCATATTGTTTTGGCTA No data
Right 1080513259 11:32996421-32996443 CCTGTAGTATAGTTTGAAGTTGG 0: 188
1: 797
2: 1153
3: 1041
4: 885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080513259 Original CRISPR CCTGTAGTATAGTTTGAAGT TGG Intergenic
Too many off-targets to display for this crispr