ID: 1080513260

View in Genome Browser
Species Human (GRCh38)
Location 11:32996422-32996444
Sequence CTGTAGTATAGTTTGAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31276
Summary {0: 199, 1: 1154, 2: 15403, 3: 8886, 4: 5634}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080513256_1080513260 2 Left 1080513256 11:32996397-32996419 CCATATTGTTTTGGCTACTGTAG No data
Right 1080513260 11:32996422-32996444 CTGTAGTATAGTTTGAAGTTGGG 0: 199
1: 1154
2: 15403
3: 8886
4: 5634
1080513255_1080513260 8 Left 1080513255 11:32996391-32996413 CCAGTACCATATTGTTTTGGCTA No data
Right 1080513260 11:32996422-32996444 CTGTAGTATAGTTTGAAGTTGGG 0: 199
1: 1154
2: 15403
3: 8886
4: 5634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080513260 Original CRISPR CTGTAGTATAGTTTGAAGTT GGG Intergenic
Too many off-targets to display for this crispr