ID: 1080514328

View in Genome Browser
Species Human (GRCh38)
Location 11:33006157-33006179
Sequence CAGAGTGAACAGATGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080514325_1080514328 8 Left 1080514325 11:33006126-33006148 CCATGGTTATTGGAAGAAAGAAA No data
Right 1080514328 11:33006157-33006179 CAGAGTGAACAGATGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080514328 Original CRISPR CAGAGTGAACAGATGTCTGG AGG Intergenic
No off target data available for this crispr