ID: 1080515447

View in Genome Browser
Species Human (GRCh38)
Location 11:33015774-33015796
Sequence CCAGCGATCCAAGTTTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080515447_1080515452 -1 Left 1080515447 11:33015774-33015796 CCCGAGGAAACTTGGATCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1080515452 11:33015796-33015818 GCGCCGCGGGCTACGTTCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
1080515447_1080515457 29 Left 1080515447 11:33015774-33015796 CCCGAGGAAACTTGGATCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1080515457 11:33015826-33015848 AGAGACACGTGACCGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1080515447_1080515456 28 Left 1080515447 11:33015774-33015796 CCCGAGGAAACTTGGATCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1080515456 11:33015825-33015847 GAGAGACACGTGACCGGCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 67
1080515447_1080515458 30 Left 1080515447 11:33015774-33015796 CCCGAGGAAACTTGGATCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1080515458 11:33015827-33015849 GAGACACGTGACCGGCAGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1080515447_1080515454 22 Left 1080515447 11:33015774-33015796 CCCGAGGAAACTTGGATCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1080515454 11:33015819-33015841 TTGCCAGAGAGACACGTGACCGG 0: 1
1: 0
2: 1
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080515447 Original CRISPR CCAGCGATCCAAGTTTCCTC GGG (reversed) Intergenic