ID: 1080515932

View in Genome Browser
Species Human (GRCh38)
Location 11:33020101-33020123
Sequence AGGTTTTCACAGTAGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080515927_1080515932 -3 Left 1080515927 11:33020081-33020103 CCCTTTAAATAGGTTTTCATAGG 0: 1
1: 0
2: 0
3: 20
4: 228
Right 1080515932 11:33020101-33020123 AGGTTTTCACAGTAGGACTAGGG 0: 1
1: 0
2: 1
3: 12
4: 115
1080515929_1080515932 -4 Left 1080515929 11:33020082-33020104 CCTTTAAATAGGTTTTCATAGGT 0: 1
1: 0
2: 2
3: 17
4: 214
Right 1080515932 11:33020101-33020123 AGGTTTTCACAGTAGGACTAGGG 0: 1
1: 0
2: 1
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080515932 Original CRISPR AGGTTTTCACAGTAGGACTA GGG Intronic
900362560 1:2296826-2296848 AGGTTTTCACAGCAGGAACGTGG - Intronic
905339657 1:37269794-37269816 AGGCTTTATCAGTAGGAGTATGG + Intergenic
905358487 1:37401764-37401786 CAGTTCTCACAATAGGACTAGGG - Intergenic
905496719 1:38394905-38394927 AGGTATTCACCCTAGGACTAAGG + Intergenic
909081163 1:71113956-71113978 AGATTTTCACAGGAGGACAATGG - Intergenic
911409904 1:97490085-97490107 AAGTTTTCACAATAGCACTATGG - Intronic
914963206 1:152225496-152225518 ATCTTTTCACAGGAGGACTAGGG + Intergenic
915808881 1:158885795-158885817 GGTTTTTCACAGTACAACTATGG - Intergenic
919269822 1:195325686-195325708 AGGTTCTCAGAGTAGAAATACGG - Intergenic
919940779 1:202284604-202284626 AGGTTTTCCCAGGAGGTCTCAGG + Intronic
920803944 1:209215931-209215953 AGGAGTTCACAGTGGGAATATGG - Intergenic
923135392 1:231113159-231113181 AGGTTTTCCCAAAAAGACTAGGG + Intergenic
924170817 1:241338621-241338643 AGGCTTTCACTGTAGGAAAATGG + Intronic
924953349 1:248906010-248906032 AGGTTTCCAAAGTAGGACAGGGG + Intergenic
1063015600 10:2073942-2073964 TGGTTTTAAGAGTAGGAATATGG - Intergenic
1064910926 10:20401038-20401060 GGGTTTTTACAGCAGGACTTTGG + Intergenic
1072893058 10:99342197-99342219 AGGTTTTGACTGTAAGCCTAGGG + Intronic
1080515932 11:33020101-33020123 AGGTTTTCACAGTAGGACTAGGG + Intronic
1082856824 11:57815903-57815925 ATGTGTTCACAGCAGGACGAGGG + Exonic
1086583737 11:88428535-88428557 AGCTTTTTAAAGTAGTACTATGG + Intergenic
1089999373 11:122941387-122941409 AGGTTTTCACTGTTGGAAAAAGG - Intronic
1093403415 12:18776213-18776235 AGGCTGTCAAAGTAGGAATAAGG + Intergenic
1096782984 12:54001501-54001523 AGGATTGCACAGGAGGGCTAGGG + Intronic
1098811719 12:75102975-75102997 AGGTTTTCACAGTAGGAGAAAGG + Intronic
1099389921 12:82067617-82067639 AAGTATTCACAGTAGCACAATGG + Intergenic
1102095882 12:110240910-110240932 AGGTCTTCTCAGTAGCACTTTGG - Intergenic
1103151454 12:118642880-118642902 AGGGGTTGACAGTAGGACTCTGG - Intergenic
1107724229 13:43281738-43281760 AAGTTTTCACTGTAGAAATACGG + Intronic
1108101926 13:46966157-46966179 AGATATTCACAATAAGACTATGG - Intergenic
1108910034 13:55537485-55537507 AGTCTTTCACACTAGGAGTAGGG - Intergenic
1111669262 13:91307894-91307916 AGGTTTTGGCAGTAGCAATACGG + Intergenic
1116602479 14:46944403-46944425 AGTTTTCCACAATTGGACTATGG + Intronic
1123221343 14:106859503-106859525 AGGTTCTCCCACTAGCACTATGG + Intergenic
1125144852 15:36455192-36455214 AGGTTTTCACAGTATGCATTTGG + Intergenic
1126904034 15:53345438-53345460 ATTCTTTCACAGTAGGACTTTGG + Intergenic
1128871642 15:71162183-71162205 GGGTATTCAGAGTATGACTATGG + Intronic
1129127814 15:73459809-73459831 ATGTTTTCACTGTAGGACCTAGG - Intronic
1130239607 15:82174725-82174747 AGGGTTTGGCAGTGGGACTAAGG - Intronic
1134982224 16:18620855-18620877 AAGTTTTGACTTTAGGACTATGG + Intergenic
1135877836 16:26220243-26220265 AGTTATTCACAGTAATACTAAGG + Intergenic
1136120405 16:28129342-28129364 AGCTTTTCACAGTGGGACACTGG - Intronic
1138166776 16:54809389-54809411 AGGACTTCACAGTAAGAGTATGG + Intergenic
1138573670 16:57892566-57892588 AGGTTTTCACAGGAGCCCTTTGG - Intronic
1139063575 16:63286188-63286210 AAGTTTTCACATTGGGAATATGG - Intergenic
1142914602 17:3125986-3126008 AGGTTTTCACATGAAGTCTAAGG + Intergenic
1153139702 18:1956410-1956432 AGGTTTTAAATGTAGGTCTACGG + Intergenic
1156405772 18:36781344-36781366 AGGTTTTAAAAGTAGGACAAAGG - Intronic
1156868888 18:41921021-41921043 AGGTTTTCACCATGGGACTGTGG - Intergenic
1159039299 18:63308359-63308381 AGGTTCTCACAGTGGGAGCAAGG - Intronic
1161783998 19:6311909-6311931 AGGTTATCAAAGTAGGATCAAGG + Intronic
1168378250 19:55898858-55898880 AGATTTTCACATTATGATTATGG + Exonic
932434508 2:71695206-71695228 GGGTTTTCACAGTAAGACTCAGG + Intergenic
932574414 2:72954882-72954904 AGTTTCTCCCAGTAGGATTAGGG - Intronic
935066123 2:99650108-99650130 AAGTTTCCACAGTTGGAATATGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
940497194 2:154446633-154446655 AGGTTTCCACAGTAGGATGCTGG - Intronic
940713376 2:157189691-157189713 CGGTTTTCATAGTAGGTGTATGG - Intergenic
942668294 2:178346368-178346390 AAGTCTACACAGTAGGTCTAAGG - Intronic
944386870 2:199175381-199175403 AGGAATTCCCTGTAGGACTAAGG + Intergenic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
945081795 2:206093491-206093513 AGGGTTACACAGTAGGAAAATGG - Intergenic
1170345358 20:15380313-15380335 AAGCTTTCAAAGTAGGACTAGGG + Intronic
1183226251 22:36551886-36551908 AGGTTCACACAGCAGGAATATGG - Intergenic
949257207 3:2062693-2062715 AGGTTTTAACAGTGGGCCCATGG + Intergenic
949811584 3:8012361-8012383 GGGTATTTACAGTAGGACTGAGG + Intergenic
951634395 3:24757049-24757071 AGGTCTTGACTGTAGGGCTAGGG + Intergenic
952160059 3:30684468-30684490 AGTTTTTCAGATTAGGAGTACGG - Intronic
952685616 3:36144627-36144649 AGGAATTCACAGTTGGAGTATGG - Intergenic
955078925 3:55639884-55639906 ATGTTTTCACACTTGGACCAAGG + Intronic
955552562 3:60100013-60100035 AGTTTTTCACAGTAGCACACTGG + Intronic
959139744 3:102471284-102471306 GGGTTTTCAGAGTAGTTCTAGGG - Intronic
960133545 3:114083485-114083507 AGATTTTCAGATTAGGAATACGG + Intronic
960294503 3:115926674-115926696 TGTATTTCACAGTAGGACTGTGG - Intronic
965510573 3:169564535-169564557 AGGTTTCCACAGCAGGTCTTAGG + Intronic
965628909 3:170710550-170710572 AGGTTTCCATAGGAGGACAATGG - Intronic
971771434 4:30902070-30902092 CGTTTGTCACAGTAGTACTATGG - Intronic
975642858 4:76517768-76517790 GGGTTTTCAGATTAGGACTCTGG + Intronic
977081456 4:92534385-92534407 ATATTTTCACAGAAAGACTATGG - Intronic
977321722 4:95524566-95524588 AGGTTCTCACTGCAGGAATATGG - Intronic
983288426 4:165769422-165769444 AGGTGATCACAGTCAGACTAAGG - Intergenic
991201642 5:64001037-64001059 AGGTTATCAGAGAAGGACTGTGG - Intergenic
993726797 5:91378442-91378464 AGGTTTTTAAAATAGGAATAGGG - Intronic
993967547 5:94375801-94375823 AAGTTTGCAGAGTAGCACTAAGG + Intronic
994191090 5:96870111-96870133 AGCTTTTGATAGTAGGACCAGGG + Intronic
997275413 5:132583287-132583309 AGGTATTCACAGTGGAAATAAGG + Intronic
1000343577 5:160295865-160295887 ACGTTGTCACAGTAGCCCTAGGG + Intronic
1000388956 5:160702816-160702838 AGGCTTTCCCAGTAGAACCAAGG + Intronic
1001099087 5:168799218-168799240 AGCTTTTCACACTAGGAGTCTGG - Intronic
1001482441 5:172097612-172097634 AGGGTCTCACTGTATGACTACGG + Intronic
1001623069 5:173105395-173105417 AGGTGTTCACAGTCAAACTAGGG + Intronic
1009824039 6:68843866-68843888 AGGATTTCACTGTAGGTGTATGG - Intronic
1010100659 6:72103508-72103530 AAGGATTCATAGTAGGACTATGG + Intronic
1010760553 6:79717595-79717617 AGATTTTCACAGAAGGAAAACGG + Intergenic
1011450490 6:87486817-87486839 AGGGTATCACAGTAGTAGTATGG + Intronic
1012221030 6:96649569-96649591 AGCTTTGCACAGTGGGAGTATGG - Intergenic
1017410957 6:154167328-154167350 ATGTTTTCACAATGGGAATAAGG - Intronic
1017611239 6:156188630-156188652 AGGTTTTCACATGAGTACTGGGG + Intergenic
1018210037 6:161472139-161472161 AGCCCTTCACAGAAGGACTAAGG + Intronic
1018444501 6:163842731-163842753 AAGTTTTCACAGAATGGCTAGGG + Intergenic
1021677957 7:23099725-23099747 GGGTTGGCACAGTGGGACTAGGG + Intergenic
1024233552 7:47380869-47380891 AGGCTTTCACAGCAGGACAGTGG + Intronic
1028788899 7:94830874-94830896 AGGTTTATACATTAGCACTAAGG - Intergenic
1030205103 7:106944808-106944830 AGGTTTTGACAGAAAGACAAAGG - Intergenic
1030947009 7:115736173-115736195 AGATTTTAACAGTATGTCTAAGG - Intergenic
1032426808 7:131829350-131829372 GGGTTTTGAAAGTATGACTATGG - Intergenic
1033417715 7:141178741-141178763 TGGTTGTCAAAGTAGGACTCAGG - Intronic
1037674617 8:21043038-21043060 AGGTTTTCTCAAAATGACTAGGG - Intergenic
1042344220 8:67711203-67711225 AGGATTTCAAAGTAGGATTGTGG - Intronic
1045729011 8:105212571-105212593 AGGGCTACACAGTAGGAGTAAGG - Intronic
1047483298 8:125305281-125305303 AGGTTTTCACAGTAGTAAAATGG - Intronic
1047921198 8:129636194-129636216 AGGATGTCACAGAAGGACTAGGG + Intergenic
1050380533 9:5023565-5023587 AGGGGTTCACAGTAGGAATGTGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055174024 9:73295905-73295927 AGCTTGTCACAGTAAGACCAGGG - Intergenic
1056729546 9:89153841-89153863 TGGGTTTAACAGTAGGACTGGGG + Intronic
1058717906 9:107738880-107738902 TGGTTGTCACACTAGGAGTAAGG + Intergenic
1059694044 9:116713958-116713980 AAGTTTTCACATTAGGAAGATGG + Intronic
1060851973 9:126885455-126885477 TGGTTTTCACATTAGGAAAATGG - Exonic
1191060306 X:56288435-56288457 AGTTTTTGAAAGTAGGACCACGG + Intergenic
1191583635 X:62794605-62794627 AGGTTTTCACTATAGGCCTCAGG + Intergenic
1192719676 X:73679022-73679044 AGGTTTTCACAGTAGTCCAGTGG + Intronic
1194227866 X:91284158-91284180 AGTTTTTAACAGTACGACTAGGG - Intergenic
1195623493 X:106983301-106983323 AGGTTTTCTCAGTAGGACACAGG + Intronic
1198046080 X:132904337-132904359 AACTTTTAACAATAGGACTATGG - Intronic
1201318594 Y:12672596-12672618 AGGTTTTCTCACTAGGAATTTGG - Intergenic