ID: 1080523328

View in Genome Browser
Species Human (GRCh38)
Location 11:33087838-33087860
Sequence ACTGAAAAGAAGACTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080523328_1080523330 -1 Left 1080523328 11:33087838-33087860 CCATCCACAGTCTTCTTTTCAGT 0: 1
1: 0
2: 3
3: 39
4: 356
Right 1080523330 11:33087860-33087882 TACACTAGCATTGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1080523328_1080523335 22 Left 1080523328 11:33087838-33087860 CCATCCACAGTCTTCTTTTCAGT 0: 1
1: 0
2: 3
3: 39
4: 356
Right 1080523335 11:33087883-33087905 GCTGAGACAAGATATGCCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 161
1080523328_1080523331 0 Left 1080523328 11:33087838-33087860 CCATCCACAGTCTTCTTTTCAGT 0: 1
1: 0
2: 3
3: 39
4: 356
Right 1080523331 11:33087861-33087883 ACACTAGCATTGCCCTGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080523328 Original CRISPR ACTGAAAAGAAGACTGTGGA TGG (reversed) Intronic
900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG + Intergenic
903186849 1:21633898-21633920 AGTGAGAAGAGGGCTGTGGAGGG + Intronic
903806514 1:26009568-26009590 ATTGAAAAGAAGTTTGTGGCAGG + Intergenic
904541670 1:31238072-31238094 ACAGATAAGAAGACTGAGGCCGG + Intronic
904733687 1:32613925-32613947 TCTGAAAAGAAGGCTGGGCACGG + Intronic
905027623 1:34861715-34861737 TCAGAAAAGAAGACTGAGGAAGG - Intergenic
905230541 1:36512467-36512489 ACTGCAAAGAAGGCTGGGGCTGG - Intergenic
905317847 1:37094931-37094953 GAAGAAAAGAAGACTGTGGTGGG - Intergenic
905479319 1:38250273-38250295 AGTGAAAATAAGAGGGTGGAGGG + Intergenic
905949512 1:41937116-41937138 ACTGGAAAGAAGACTGTTAATGG - Intronic
906506726 1:46385763-46385785 ACTGAAAAAAAAAATGTGGGGGG - Intergenic
908014847 1:59820440-59820462 AGTGCAAAGAAGGCTGGGGAAGG - Intronic
909587831 1:77311069-77311091 ACAGAAAAGAAGGCTGTCTAGGG - Intronic
909862450 1:80625320-80625342 ACTGAAAATTAGACTGGGCATGG - Intergenic
910339543 1:86170007-86170029 AATGAAAAGAAGAGGGTGAATGG + Intergenic
911288186 1:96023835-96023857 ACTGAAAAGATGTCTGGGCATGG + Intergenic
911382161 1:97128891-97128913 AGAGAAAAGTAGAGTGTGGATGG + Intronic
911549649 1:99263993-99264015 ACTGAAAAGTAGGCTGAGGTAGG - Exonic
911929072 1:103877975-103877997 ACTCTAAAGATCACTGTGGATGG - Intergenic
913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG + Intergenic
913314530 1:117538858-117538880 AAGGAAAAGAAGGCTGTGTATGG + Intergenic
914194563 1:145438877-145438899 ATTAAAAAGAATCCTGTGGACGG - Intergenic
914475896 1:148021759-148021781 ATTAAAAAGAATCCTGTGGACGG - Intergenic
915301752 1:154955689-154955711 AATGAAAAGAAGGGGGTGGAGGG - Intronic
916433444 1:164754570-164754592 ACTGAAAAAGTGACTGTGTAAGG + Intronic
916607748 1:166359631-166359653 GCTGCAAAGGGGACTGTGGATGG - Intergenic
917800286 1:178563449-178563471 GCAGAAAAGGAGACTGTGGAGGG + Intergenic
918512299 1:185324692-185324714 ACTAAAAAGAAAAATGTGAAAGG + Intergenic
919915823 1:202138448-202138470 ACTGGAAAGAAGACTCAGAATGG + Exonic
919917988 1:202150862-202150884 AGTGGAGAGAAGACTGTGGGAGG - Intronic
920415669 1:205797839-205797861 TTTAAAAAGAAGTCTGTGGAAGG + Intronic
920769093 1:208863697-208863719 ACTTAAAAGAGGAGTGTTGATGG + Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
924676126 1:246179817-246179839 ACTTAGAAAGAGACTGTGGATGG - Intronic
924832067 1:247606710-247606732 ATTGAAAAGAGAGCTGTGGATGG + Intergenic
1062942077 10:1430219-1430241 ACTGATAAGAAAACTGTAAAAGG + Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1065165352 10:22970985-22971007 AATGAAAAGATTTCTGTGGATGG - Intronic
1066163954 10:32765344-32765366 ACTGGAAAGGAAACTATGGAGGG + Intronic
1067061186 10:43078710-43078732 ACTGAACGCAAGGCTGTGGAAGG - Intronic
1071329453 10:84545258-84545280 ACTGAAAAGAATATTTTGGCTGG - Intergenic
1071439476 10:85677762-85677784 AGTGAAAAGAGGAGTGTTGAAGG + Intronic
1071813715 10:89209637-89209659 AGTGAAAACAACACTGGGGAAGG - Intergenic
1074684716 10:115949907-115949929 GCTGAAAAGGAGAGTGTGCAAGG - Intergenic
1077480068 11:2809956-2809978 ACTGATAAGAACTGTGTGGAAGG + Intronic
1078382447 11:10857079-10857101 ATCCAAAAGGAGACTGTGGAAGG - Intronic
1078619712 11:12895932-12895954 ACTGAAAGGAAGACGGAGGGGGG - Intronic
1078619723 11:12895989-12896011 ACTGAAAGGAAGACGGAGGGGGG - Intronic
1079282483 11:19099876-19099898 GCAGAAAAGAGGACTGAGGAGGG - Intergenic
1079588682 11:22156103-22156125 AGTGAAATGAAGGCAGTGGAAGG + Intergenic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080989483 11:37513437-37513459 ACTAAAAAGAAAAGTATGGATGG + Intergenic
1081152772 11:39652372-39652394 ACTGACGAGAAGAGTGAGGAAGG + Intergenic
1084093961 11:66897948-66897970 ACTGAAAAGAAAATTGAGGCTGG + Intronic
1084598633 11:70132040-70132062 ACAGAGAAGAAGACCGTGGCGGG - Exonic
1087175875 11:95094698-95094720 AATGAAAAGAAGGCTGAGGTTGG - Intronic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1087678744 11:101193740-101193762 ACTGAAAAGAAGAGAGTAGTTGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087862761 11:103182657-103182679 CATGCAAAGAAGACCGTGGAGGG + Intronic
1089220500 11:116867110-116867132 ACTGAAAAGCAGCCTTGGGAAGG - Intronic
1089400040 11:118159194-118159216 CCTAAAAAGAAGACTGCAGAGGG + Intergenic
1089929119 11:122291675-122291697 AATGAAAAGAGTTCTGTGGATGG + Intergenic
1090335024 11:125956258-125956280 CCAGAAAAAAAGTCTGTGGATGG + Exonic
1091900124 12:4137702-4137724 AGTGAAGAAAAGACTGTGGGTGG - Intergenic
1093025779 12:14244059-14244081 ACTGCATAGATTACTGTGGAAGG - Intergenic
1093178669 12:15943322-15943344 ACTAAAAGGAATACAGTGGAGGG - Intronic
1094262507 12:28517283-28517305 ACTGAAAACAAGAATGTGGTGGG + Intronic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1095520690 12:43061602-43061624 ATTGAAAGGGAGCCTGTGGAAGG - Intergenic
1096184809 12:49571863-49571885 ACTGCAGAGAAGTCTGTGGGAGG + Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098443780 12:70545707-70545729 AATGGAAAGAAGACTGTGAAAGG + Intronic
1099064975 12:77964512-77964534 ATTTACAAGAATACTGTGGATGG + Intronic
1099127850 12:78788346-78788368 ACTGAAAAGTAGAGTATGGATGG + Intergenic
1100121954 12:91378912-91378934 ATTGAAAATAAGAATGTGGAGGG - Intergenic
1100243567 12:92733929-92733951 ACTGACAAGTAAACTGTGGGTGG + Intronic
1102687104 12:114733896-114733918 AGTGAAAAGAAGGCTGAGCATGG - Intergenic
1102782412 12:115576539-115576561 AATGAAAGGAAGACAGTGGAGGG - Intergenic
1103150148 12:118630705-118630727 ACTGAGAAGAAGACCATGCATGG + Intergenic
1104306064 12:127611827-127611849 ACCACAAAGAAGACTGAGGAAGG - Intergenic
1104427398 12:128689106-128689128 ACAGAAAAGAAGCCTGGGCACGG - Intronic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1105488230 13:20859176-20859198 ACTGAAAAGGAGGCTGGGCACGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106238193 13:27883765-27883787 ACAGAAAAGAAGTCAGTGGTAGG + Intergenic
1107206283 13:37793236-37793258 ACTGGAGAAATGACTGTGGAAGG + Intronic
1108136640 13:47370258-47370280 ACTGAAAGGAAAAATGGGGAGGG + Intergenic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1109019458 13:57068676-57068698 ACTGAAAAGAAGAAGGTGAATGG + Intergenic
1109364079 13:61332971-61332993 AGTGAAAAGAATACTGAGTAGGG - Intergenic
1110783738 13:79497990-79498012 ACTGAAGAGAAGTGGGTGGATGG + Intronic
1111411096 13:87877676-87877698 ACTGAAAATGAGACTGTGCATGG - Intergenic
1112454136 13:99542938-99542960 ACTGAACAGAAGTCCCTGGAGGG - Intronic
1113116035 13:106875774-106875796 AGTGAGAGGAAGCCTGTGGAGGG + Intergenic
1113636496 13:111922556-111922578 AATTCAAAGAAGACTGTGCAGGG - Intergenic
1114939208 14:27585883-27585905 ACTGAAAACAAGTCTGTGCCAGG - Intergenic
1117348619 14:54858977-54858999 ACAGAAAAGAAGATTGTAGCAGG + Intronic
1118061095 14:62138555-62138577 ACTGATAAAAAGAAAGTGGAGGG - Intergenic
1118573941 14:67222804-67222826 ACATAAAAGAACACTATGGAAGG + Intronic
1118982791 14:70730092-70730114 AAGGCAAGGAAGACTGTGGAGGG + Exonic
1119259650 14:73230208-73230230 ACTGAAAGGCAGACTGTGACGGG - Intergenic
1119404274 14:74387009-74387031 CCTGAAAAGAATAATGGGGAGGG + Intergenic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1120030708 14:79637553-79637575 ACTGCAGAGAAGACTGTTGTGGG + Intronic
1120489156 14:85154628-85154650 AATGCATAGAAGAATGTGGAAGG + Intergenic
1123435958 15:20254596-20254618 ACTATAAAGAAGTCAGTGGAAGG - Intergenic
1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG + Intronic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1125892488 15:43276770-43276792 ACTGCACAGGAGACTGAGGAGGG + Intronic
1128982171 15:72196203-72196225 CCTGATCAGAAGACTATGGAGGG + Intronic
1129523210 15:76198621-76198643 ACTGGACAGAAGACTATGGTTGG - Intronic
1130563079 15:84973917-84973939 CTTGAAGAGAAGACTGTGGAGGG - Intergenic
1132925521 16:2427382-2427404 CCTGAAACGAGGACTGAGGAGGG - Intergenic
1134281676 16:12822375-12822397 ACAGAAAAGAAGAGTTTAGATGG + Intergenic
1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG + Intronic
1135238518 16:20781723-20781745 GCTGAACAGAAGACTGTGATGGG - Exonic
1135545669 16:23364492-23364514 AGTGACAAGAAGCCTTTGGAGGG + Intronic
1136848641 16:33596384-33596406 ACTATAAAGAAGTCAGTGGAAGG + Intergenic
1137775874 16:51053897-51053919 GCTGAAAAGAGGACAGTGTAGGG + Intergenic
1138983369 16:62297310-62297332 AAAAAAAAGAAGACAGTGGAAGG + Intergenic
1139515597 16:67450743-67450765 ACTGAAGAGAAGAATTCGGAAGG + Intronic
1140454708 16:75098294-75098316 ACAGGAAAGAGGACTGTGGGAGG + Intronic
1140864253 16:79046096-79046118 ATAGAAAAGAAAACTGTGGCCGG - Intronic
1141106971 16:81241924-81241946 ACAGAAAAGAACACTGAGGCAGG - Intronic
1141771067 16:86089909-86089931 GCTGAGAAGAGGACTGTGGAGGG - Intergenic
1203110348 16_KI270728v1_random:1445034-1445056 ACTATAAAGAAGTCAGTGGAAGG + Intergenic
1142773396 17:2116431-2116453 ACTGAAAAGATGGCTGGGCATGG + Intronic
1143857521 17:9863193-9863215 GCTGGAGAGAGGACTGTGGAGGG - Intronic
1144087214 17:11821648-11821670 AAAGAAAAAAAGACTGTTGAAGG + Intronic
1144159021 17:12538857-12538879 ACTAAAAATAAGAATGGGGAAGG + Intergenic
1144712665 17:17412548-17412570 ACAGAAGAGAAGACTATGAATGG - Intergenic
1147637901 17:41975029-41975051 ACTGAACAGAGGGCAGTGGAGGG - Exonic
1148201432 17:45752528-45752550 ACTGAAAAGGAGAGAATGGAAGG - Intergenic
1148657264 17:49296095-49296117 AATGCCAAGGAGACTGTGGAGGG + Exonic
1149278229 17:55069774-55069796 AATTAAATGAAGACTCTGGATGG - Intronic
1150363967 17:64564620-64564642 ACAGGAAAGAAGACTATGGGAGG + Intronic
1151266730 17:72962347-72962369 GCTGAAATGAAGACAGTGGCTGG + Intronic
1151510204 17:74553988-74554010 TCTAAAAAGAAGATTGTGGCTGG - Intergenic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1154457541 18:14543812-14543834 ACTGAGGAGAAGCCTGTGGTGGG + Intergenic
1155038006 18:22041658-22041680 ACTGACAAGAGGCCTGTGGGTGG - Intergenic
1155376070 18:25159111-25159133 ACTGTAAAGAAGGCTCTGAATGG - Intronic
1155755413 18:29489051-29489073 ACAGAAATGAGGACTGTGGAAGG - Intergenic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1156128373 18:33936519-33936541 ATTGAAAAGAACACAGTGGAGGG - Intronic
1156319391 18:36004547-36004569 ACCGAAAAGAATACTGAGGCTGG - Intronic
1156362973 18:36400573-36400595 TCTGAGAAGGAGACTGTGGTTGG + Intronic
1156579339 18:38356794-38356816 AATGAAAAGAAAATTGTGGCCGG - Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1157105083 18:44766593-44766615 AATGAAAAGAGTTCTGTGGATGG + Intronic
1157225603 18:45860479-45860501 ACTGGAAGGAAGGCTCTGGATGG + Intronic
1159119563 18:64152979-64153001 AGTAAAAAGAAGACTGGGTATGG - Intergenic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1161717656 19:5886083-5886105 ACAAAATAGAAGACTTTGGATGG + Intronic
1161810666 19:6469325-6469347 AAAAAAAAGAAGACTGTGGCTGG - Intronic
1161885033 19:6988013-6988035 ACTAGAAAGAACACTGTGGGTGG + Intergenic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1167041708 19:47026657-47026679 ACTGAAAAGAAAAGTGCGGCCGG + Intronic
1168620482 19:57875644-57875666 ACTGGAGAGAACACTGTAGATGG + Intronic
925303699 2:2834874-2834896 ACTGAAAAGAAGACTGGATGGGG + Intergenic
926414527 2:12635973-12635995 ACTGAAAAAAAAATTGTTGATGG - Intergenic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
927958516 2:27224898-27224920 AATGAAAAGAGGACTGGGCAGGG + Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928560518 2:32479553-32479575 ACTGAACTGAGGACTGTTGAAGG - Exonic
929836283 2:45403410-45403432 ACATAAAAGAACACTGAGGAAGG - Intronic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931458440 2:62430608-62430630 GATGAAAAGAATTCTGTGGATGG + Intergenic
931852280 2:66263711-66263733 ACTGTAAAGAAGTCAGTGGATGG - Intergenic
932065862 2:68559281-68559303 ACAGAAAAGAAGGCTAAGGAAGG - Intronic
932998141 2:76882952-76882974 ATTGAAAGGAAGACATTGGAAGG - Intronic
933541158 2:83644266-83644288 ACAGAAAAGATGGCTGTGCAAGG - Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
934902439 2:98171502-98171524 ACTGAAAAGAGGAGTGTGGCTGG + Intronic
935211725 2:100944479-100944501 GCTGTAAAGACGGCTGTGGATGG + Intronic
935608387 2:104994435-104994457 ACTTAAAAGATGACAGTGTAGGG + Intergenic
937192090 2:120112076-120112098 AATAAAAAGAAGACTGGGCAGGG - Intronic
938374442 2:130796528-130796550 ACAGAGGAGAAGGCTGTGGAAGG - Intergenic
938612424 2:132961621-132961643 AGTGTAAAGAACTCTGTGGAAGG + Intronic
939285233 2:140121144-140121166 ACTGGAAATAAGAATGTGGTTGG - Intergenic
939362874 2:141196456-141196478 ACTGAAAATTAGATTGTGGGAGG - Intronic
939679088 2:145108460-145108482 TCTGAAAAGAGGAATGTGGTAGG + Intergenic
940501655 2:154501625-154501647 AGTGAAAAGAACAATGTGGGAGG - Intergenic
940506790 2:154565610-154565632 AGTGAAAAGAAGGCTGGGCATGG - Intergenic
940738701 2:157482362-157482384 TCTGAAAGGAAGACTGAGGTGGG + Intronic
941471784 2:165897117-165897139 AATGAAAAGTACACTGTGTAGGG - Intronic
941701977 2:168613354-168613376 TGTGAAAAGAAGGCTGAGGATGG + Intronic
941947588 2:171116767-171116789 ACTTAAATGAGGAATGTGGATGG + Intronic
942167929 2:173260813-173260835 TCGGAAAAGAAGATTGTGGGAGG + Intronic
942236827 2:173918592-173918614 ACTGTAAAGAAGGTGGTGGAAGG - Exonic
942329228 2:174804483-174804505 AGTGGAAAACAGACTGTGGAAGG + Intronic
942912917 2:181267437-181267459 ACTGAAATGAAGTATGTTGATGG + Intergenic
944636903 2:201683446-201683468 AGTGAAAATAAAACTGAGGAGGG + Intronic
945155553 2:206833885-206833907 GCTGGAAAGTAGACTCTGGATGG + Intergenic
945863662 2:215152568-215152590 ACAGAAAAGAAGACTGTTGTAGG - Intergenic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
946995604 2:225387979-225388001 TCAGTAAAGAAGACTGTGGAAGG - Intergenic
1169903180 20:10573321-10573343 ACTGAAGGGAAGTCTATGGATGG - Intronic
1170805046 20:19622159-19622181 ACTTGAAAGGAGACTGGGGATGG + Intronic
1170954102 20:20962623-20962645 ACTGAAAAGAATTTTGTAGATGG - Intergenic
1171316519 20:24200369-24200391 ATTGAAGGGAAGACTGAGGAGGG - Intergenic
1172799404 20:37565481-37565503 ACAGAAAGGACGACTGAGGAGGG + Intergenic
1172870650 20:38133509-38133531 TCTGAAAAGAACACTGAGGCTGG + Intronic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1174818622 20:53708734-53708756 AAAGAAAAGAAGACAGGGGAGGG - Intergenic
1174867275 20:54149732-54149754 AGTGGAAAGATGACTATGGAAGG + Intergenic
1176816616 21:13609526-13609548 ACTGAGGAGAAGCCTGTGGTGGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177867036 21:26524845-26524867 ACTGGAAATAAGGCTGTAGAGGG - Intronic
1178075117 21:29008456-29008478 ATTGAAAAGAAGACAATGGAGGG - Exonic
1180237763 21:46474469-46474491 ACTGCAGGGAAGACTGAGGAAGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183118296 22:35709072-35709094 AGTCAAAAGATGAGTGTGGATGG + Intergenic
949475159 3:4437646-4437668 AGTGAAAAGAAGGCTGGGCACGG + Intronic
950812263 3:15660138-15660160 ACAGACAAGAAAACTGTGGTGGG + Intergenic
951001631 3:17568012-17568034 TCTGAAGAGAAGAGTTTGGAAGG - Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951391832 3:22114547-22114569 AATGAAAAGAAGCCAGTGGAAGG + Intronic
951569234 3:24044612-24044634 ACTGAAAAGAAGAGGGTAAACGG - Intergenic
953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG + Intergenic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
955375940 3:58397398-58397420 ACTGATTGGAAAACTGTGGAGGG + Intronic
956153444 3:66267929-66267951 ACTGGGAAGGAGACTTTGGAGGG - Intronic
956298856 3:67746710-67746732 ACTCAAAAGGTTACTGTGGATGG - Intergenic
956675893 3:71731441-71731463 ACTGAAAAAAATAATGAGGAAGG - Intronic
957204654 3:77180617-77180639 AATGAAAAAAAGACTGTAAATGG + Intronic
957499402 3:81034503-81034525 ACTGAATAGAAGACGGTTGAGGG + Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958936642 3:100262432-100262454 ACTGAAAAGAAGGCTGGGCGCGG + Intronic
959662586 3:108886043-108886065 ACTGCAAAGAAGGCTGAGGTAGG - Intergenic
959890582 3:111550731-111550753 TCAGAAAAGAAGATTGAGGAAGG + Intronic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
961541630 3:127604163-127604185 ACTGAAAAGACTTTTGTGGATGG - Intronic
963090413 3:141478375-141478397 ACTGTAGAGAAGAGCGTGGAGGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963180616 3:142351666-142351688 AATGAAAAGAAAACTGTTGTTGG - Intronic
964734086 3:159898566-159898588 AAAGAAAAGAAGAAAGTGGAAGG - Intergenic
965842011 3:172917010-172917032 AAAGAAAAGGAGACTGTGCAAGG - Intronic
966685000 3:182683711-182683733 ACTGAAAACAACACAGTGCACGG + Intergenic
967006749 3:185391162-185391184 AATGAAAAGAGTTCTGTGGATGG - Intronic
967141632 3:186566737-186566759 ACTCAAAAGAAGGGCGTGGAAGG + Intronic
967399108 3:189040968-189040990 AAAGACCAGAAGACTGTGGAGGG - Intronic
967578794 3:191127159-191127181 AAGGAAAAGAAGAATGTGTATGG - Intergenic
969880475 4:10169431-10169453 ACTGAAAAAAAGATTTGGGAAGG - Intergenic
970851674 4:20611237-20611259 ACTGAAAAGAAGGCTTTGAGTGG - Intronic
971863681 4:32141463-32141485 GCTGAAAAAAAGACTGAAGATGG - Intergenic
974386238 4:61203368-61203390 ACTCTAAAGGAGACTGTGGCAGG - Intronic
974757642 4:66232051-66232073 ACAGAAAAAAAGAATATGGATGG - Intergenic
975420683 4:74160118-74160140 ATAAAAAAGATGACTGTGGATGG - Intronic
976637911 4:87306609-87306631 ACTGAAAGGAAGAGAGTGGCTGG + Intronic
977634797 4:99284958-99284980 ACTGGAAACAAGGCTGTGGCAGG - Intronic
977637507 4:99316452-99316474 ACTGAAAACAATGCTGTGGCAGG - Intronic
978185112 4:105848478-105848500 ACTGAGAAGACTACTCTGGATGG - Intronic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978668532 4:111216467-111216489 ACTAAAACGAAGAATGAGGATGG - Intergenic
979104953 4:116672695-116672717 ACAGAAAAGAAGACAGTTTATGG - Intergenic
980828881 4:138105567-138105589 AATGAAACAAAGACTGAGGAAGG + Intergenic
980843758 4:138299408-138299430 ATTGAAATCATGACTGTGGAAGG - Intergenic
981517089 4:145621040-145621062 TCTGAAAGGAGGACTGAGGAGGG + Intronic
982578857 4:157152954-157152976 GCTAAAAAGAATACTGTGAATGG + Exonic
982591099 4:157312105-157312127 ACATAACAGAAGACTGTGGAAGG + Intronic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
983658719 4:170110147-170110169 ACAGAAAAGAAGTCTGTGTAGGG + Intergenic
984443348 4:179801448-179801470 ACTGAAAGGAAATCTGTGAAGGG + Intergenic
984640955 4:182163715-182163737 ACTGAAAAGTAGACTCTGGGAGG - Intronic
984679121 4:182586395-182586417 ACTGAAAAGAATACTGAATATGG - Intronic
984775553 4:183478605-183478627 AGTTAAAAGAAAACTGTGGTTGG - Intergenic
985096634 4:186418721-186418743 ACTGAAAAGAGGAAAGTTGAAGG - Intergenic
986046914 5:4047299-4047321 ACTAAAAAGAAGACAAAGGAAGG + Intergenic
986314747 5:6579136-6579158 CCTGAAGAGAAAAATGTGGATGG - Intergenic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
987377653 5:17251483-17251505 ACAGAAACCAACACTGTGGAAGG - Intronic
987546111 5:19312131-19312153 ATAGAAGTGAAGACTGTGGAAGG - Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
989139001 5:38183643-38183665 AATAAATAGAAGACTATGGAAGG - Intergenic
989461156 5:41699919-41699941 ACTGAAAGGAGGAGTGTAGATGG - Intergenic
990495511 5:56343815-56343837 ACTGATGAGAAGACTGAGGCAGG - Intergenic
991039856 5:62163951-62163973 ACACCAAGGAAGACTGTGGAAGG + Intergenic
992775300 5:80083639-80083661 CCAGAATAGAAGTCTGTGGAAGG - Intergenic
993479442 5:88405837-88405859 AGATAAAAGAAGACTGTGGCAGG - Intergenic
995225052 5:109691258-109691280 ACTTTAAATAAGACTTTGGATGG - Intronic
995658046 5:114449232-114449254 ACTGAAAAGAGGGCTGGAGAAGG - Intronic
996322345 5:122232923-122232945 ACTCAAATCAACACTGTGGATGG + Intergenic
997100737 5:130966159-130966181 AGTGAAAAGCAAACTGTAGAGGG + Intergenic
998306830 5:141085899-141085921 AATGAAAAGAAAACTCTGGTAGG - Intergenic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
1000063059 5:157672995-157673017 ACAAAAAAGACAACTGTGGAAGG - Intronic
1000166153 5:158650640-158650662 ACTGTGAAGAAGAGTGTGGCTGG - Intergenic
1001465586 5:171962308-171962330 ACTTAACAGAAGACTTTGGAGGG + Intronic
1001935274 5:175699208-175699230 AATGAAAAGAACACTGTGATTGG + Intergenic
1003431455 6:6042301-6042323 ACTAATAAGAAAACTGTAGAAGG - Intergenic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1004695242 6:18027164-18027186 ACTGAGAAGAAGCCTGGGCATGG + Intergenic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005349544 6:24920794-24920816 ACTGAAATGAAGACTGCTGCTGG - Intronic
1005384875 6:25276179-25276201 TCTGACTAGAAGACGGTGGAAGG - Intergenic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1008551330 6:52634837-52634859 AAAGAAAAGAAGACTCTGAAAGG + Intergenic
1008817162 6:55581633-55581655 AATAAAAAGAAGTTTGTGGAAGG + Intergenic
1009722027 6:67484610-67484632 TGTGGAAATAAGACTGTGGATGG - Intergenic
1010726064 6:79335191-79335213 ACTGAAAATATAACTGTGGCTGG - Intergenic
1011793905 6:90931717-90931739 ACAGAACAGAATACTGAGGAAGG + Intergenic
1012104638 6:95140733-95140755 ACTGAATAGGAAACTGTTGAAGG + Intergenic
1012247675 6:96943858-96943880 ACTGAAAAGAAGGTTGTTGGAGG + Intronic
1012271693 6:97220279-97220301 AGGTAAAAGAAGACTGTGGATGG + Intronic
1012416161 6:99016410-99016432 ACTGAAGAGGAAACTGTGGTTGG + Intergenic
1012898405 6:104978154-104978176 ACTGAAAAAAAGAAGGTGGGGGG - Intronic
1013218447 6:108053208-108053230 AATGAAAAGAAGACTGTTTATGG + Intronic
1013259049 6:108419983-108420005 AATGAAATGAAAACTGTGGCAGG - Intronic
1013589714 6:111609799-111609821 GCTGAAAAGCAGCCTGAGGATGG + Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1017932697 6:158973031-158973053 ACTGTGAACAAGATTGTGGAAGG + Intronic
1018953782 6:168394758-168394780 ACCGAACAGGAGACTGTTGACGG - Intergenic
1020697630 7:11434510-11434532 GCTGAAAGGAATACTGTTGATGG + Intronic
1021569997 7:22055523-22055545 TCTGAATATGAGACTGTGGATGG - Intergenic
1022074026 7:26947918-26947940 ACTCTATAGAATACTGTGGATGG + Intronic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1022596287 7:31716249-31716271 AATGAAAATAAGGCTGTGGAAGG - Intergenic
1022684012 7:32577793-32577815 ATTGAAAAGAAGGCTGAAGAAGG + Intronic
1023939353 7:44760048-44760070 AGTGTAAAGAAGACCGTGTATGG + Intronic
1024561318 7:50647848-50647870 ACTCAAAAGAGGAGTGAGGAAGG + Intronic
1026894732 7:74003413-74003435 TCTGGAAAGAAGATTCTGGAAGG - Intergenic
1026894747 7:74003490-74003512 CCTGGAAAGAAGATTCTGGAAGG - Intergenic
1027994265 7:85404470-85404492 AGTGAAAAGAATACAGTGGGAGG + Intergenic
1028577783 7:92371387-92371409 CCTGCAAAGAAAAGTGTGGAGGG + Intronic
1029552919 7:101247529-101247551 ACTGAAAACAGGACTGAAGACGG + Intronic
1030899968 7:115111110-115111132 AGAGAAAAGAAGAGGGTGGAAGG - Intergenic
1032142401 7:129344692-129344714 TTGGAAAAGAAGACTGTTGATGG + Intronic
1034453789 7:151153064-151153086 GGTGGAAAGAAGACTGGGGAAGG + Intronic
1035496336 7:159330237-159330259 AGTGAAAAGAACACTGTGTAAGG - Intergenic
1036225710 8:6955855-6955877 ACTGGAAAACAGATTGTGGATGG - Intergenic
1036228703 8:6981812-6981834 ACTGAACAATGGACTGTGGATGG - Intergenic
1036231155 8:7000922-7000944 ACTGAACAATGGACTGTGGATGG - Intronic
1036233603 8:7020021-7020043 ACTGAACAATGGACTGTGGATGG - Intergenic
1036949916 8:13131532-13131554 ACTCAAAACAAGACTGGGGATGG + Intronic
1037081598 8:14794148-14794170 ACTGAGTAGAAGACTGTAGCTGG - Intronic
1037586884 8:20283120-20283142 ACTGAAAAGAAGACACTTCATGG + Intronic
1038032096 8:23651424-23651446 ACTGAAAGGAAGTCTGTGGATGG - Intergenic
1038382374 8:27108222-27108244 ACAGAAAAGTATTCTGTGGATGG + Intergenic
1039275836 8:35933544-35933566 ACTACAAAGAGGACTGAGGAAGG - Intergenic
1039350491 8:36758845-36758867 ACTGAGAATAAGACTGAGGGAGG - Intergenic
1039796364 8:40918840-40918862 TCTGAAAAAAACACAGTGGAAGG + Intergenic
1040774540 8:51024022-51024044 ACTGAAAATAAGACAGTGATGGG - Intergenic
1040809254 8:51432407-51432429 ACTGAAAGGATGATTCTGGAAGG - Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042178751 8:66063518-66063540 ACTGAAAAGAAGAGTATGTGAGG + Intronic
1042287047 8:67124967-67124989 ACTTAAAAGACAACTATGGATGG - Intronic
1042386339 8:68179488-68179510 ATTGAAAACAACACTGGGGAAGG + Intronic
1042778803 8:72467224-72467246 ATTGAAAGGATGACTGAGGATGG - Intergenic
1043667535 8:82835546-82835568 AGTGAAAAGAGGTCTGGGGAAGG - Intergenic
1044396310 8:91717025-91717047 CCTGAATTGAAAACTGTGGAAGG - Intergenic
1045271257 8:100663666-100663688 ACTGTAAATAAGAATGTGGCTGG + Intergenic
1045601286 8:103720064-103720086 ATTGAAATGAAGGGTGTGGAAGG + Intronic
1046021097 8:108666030-108666052 GTTGAATAGAAGACTGTGGAGGG + Intronic
1046524070 8:115361511-115361533 TCTGGAAAGGTGACTGTGGATGG - Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1047534395 8:125706227-125706249 TGTGAAGACAAGACTGTGGATGG - Intergenic
1048846015 8:138604301-138604323 GCTGGGTAGAAGACTGTGGAGGG + Intronic
1050098015 9:2087641-2087663 TCTTAAGAGAAGACAGTGGAAGG - Intronic
1050162928 9:2736578-2736600 ACAGAAGAGCACACTGTGGATGG - Intronic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1051527032 9:18056834-18056856 ACTGAAGAGAGGTCTGTGAAGGG - Intergenic
1053546319 9:39026752-39026774 ACTGATCAGAGGACTTTGGAGGG + Intergenic
1053550649 9:39076046-39076068 GATGAAAAGGAGTCTGTGGAAGG - Intronic
1053814758 9:41896145-41896167 GATGAAAAGGAGTCTGTGGAAGG - Intronic
1054615838 9:67291296-67291318 GATGAAAAGGAGTCTGTGGAAGG + Intergenic
1055440037 9:76328219-76328241 ACTGAGAAGAAGGCTGTTCATGG - Exonic
1057188737 9:93074053-93074075 ACTGAGAAGATTACTGTGGCTGG - Intronic
1057484552 9:95472390-95472412 ACTGAGAGGACGTCTGTGGACGG + Intronic
1061684864 9:132267252-132267274 ACTGAAGACAGGTCTGTGGAGGG + Intronic
1203530740 Un_GL000213v1:139941-139963 ACTGAGGAGAAGCCTGTGGTGGG + Intergenic
1186108243 X:6228114-6228136 AATAAACAGAAGACTGTGGCGGG - Intronic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1188308687 X:28589650-28589672 ATTGAAATGATGACTGTGAACGG + Intronic
1188385772 X:29555833-29555855 AAGGAAAAGAACACTGGGGAGGG + Intronic
1188535278 X:31190229-31190251 TCTGAAGAGGAGACTGTAGAGGG + Intronic
1188850909 X:35131119-35131141 TGTGGAAAGAAGACTGGGGATGG - Intergenic
1189367718 X:40402005-40402027 AAGGAAAAGAGGACTGTGAATGG + Intergenic
1189567868 X:42261984-42262006 ACTGAAAAGAAGAATGAGTATGG - Intergenic
1192356635 X:70410281-70410303 ACTGAAAAGGAGACTGAAGCAGG + Intronic
1192591559 X:72364140-72364162 ACTGAAAAGAAGACCTTAGTTGG - Intronic
1192799114 X:74449055-74449077 AATAAAAAGATGGCTGTGGAAGG + Intronic
1194697731 X:97076132-97076154 ACTGTAAAGATTTCTGTGGAAGG + Intronic
1195496745 X:105544801-105544823 ACTGAAAAGAATGCAGTGAAGGG - Intronic
1197691238 X:129503187-129503209 ACAGGAAAGAAGACTGTAGAAGG + Intronic
1198012540 X:132573049-132573071 TTTGAAAAGAACATTGTGGATGG + Intergenic
1198054732 X:132982602-132982624 ACTGAAATGAAGCCTTTTGAAGG - Intergenic
1200776064 Y:7171359-7171381 ACTAAAAAGAGGACAGAGGAAGG - Intergenic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201489154 Y:14523363-14523385 AATTAAAGGAAGACTGTGGCGGG + Intronic