ID: 1080531720

View in Genome Browser
Species Human (GRCh38)
Location 11:33182721-33182743
Sequence GACCTTGACCTGCTGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080531720_1080531724 -7 Left 1080531720 11:33182721-33182743 CCTTCCAGCAGCAGGTCAAGGTC No data
Right 1080531724 11:33182737-33182759 CAAGGTCCAGTCCTTTCTTGGGG No data
1080531720_1080531722 -9 Left 1080531720 11:33182721-33182743 CCTTCCAGCAGCAGGTCAAGGTC No data
Right 1080531722 11:33182735-33182757 GTCAAGGTCCAGTCCTTTCTTGG No data
1080531720_1080531723 -8 Left 1080531720 11:33182721-33182743 CCTTCCAGCAGCAGGTCAAGGTC No data
Right 1080531723 11:33182736-33182758 TCAAGGTCCAGTCCTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080531720 Original CRISPR GACCTTGACCTGCTGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr