ID: 1080531722

View in Genome Browser
Species Human (GRCh38)
Location 11:33182735-33182757
Sequence GTCAAGGTCCAGTCCTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080531720_1080531722 -9 Left 1080531720 11:33182721-33182743 CCTTCCAGCAGCAGGTCAAGGTC No data
Right 1080531722 11:33182735-33182757 GTCAAGGTCCAGTCCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080531722 Original CRISPR GTCAAGGTCCAGTCCTTTCT TGG Intergenic
No off target data available for this crispr