ID: 1080533283

View in Genome Browser
Species Human (GRCh38)
Location 11:33197578-33197600
Sequence CAGAGCCAGGAGATGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080533280_1080533283 18 Left 1080533280 11:33197537-33197559 CCTTCATATTAAAGTTTGGGAAG No data
Right 1080533283 11:33197578-33197600 CAGAGCCAGGAGATGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080533283 Original CRISPR CAGAGCCAGGAGATGGAATC AGG Intergenic
No off target data available for this crispr