ID: 1080534507

View in Genome Browser
Species Human (GRCh38)
Location 11:33208325-33208347
Sequence CTGATGGTCTGACGGTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080534507_1080534510 -3 Left 1080534507 11:33208325-33208347 CCATCTTACCGTCAGACCATCAG No data
Right 1080534510 11:33208345-33208367 CAGAGCTATACATGTCTTAGAGG No data
1080534507_1080534511 7 Left 1080534507 11:33208325-33208347 CCATCTTACCGTCAGACCATCAG No data
Right 1080534511 11:33208355-33208377 CATGTCTTAGAGGTAAAAGCTGG No data
1080534507_1080534512 18 Left 1080534507 11:33208325-33208347 CCATCTTACCGTCAGACCATCAG No data
Right 1080534512 11:33208366-33208388 GGTAAAAGCTGGAACTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080534507 Original CRISPR CTGATGGTCTGACGGTAAGA TGG (reversed) Intergenic
No off target data available for this crispr