ID: 1080538787

View in Genome Browser
Species Human (GRCh38)
Location 11:33246795-33246817
Sequence CTCAGTTAACTGTACAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080538787_1080538793 14 Left 1080538787 11:33246795-33246817 CCCAAGTTGTACAGTTAACTGAG No data
Right 1080538793 11:33246832-33246854 TGTCAAAAGGCAAGAAAGGAAGG No data
1080538787_1080538792 10 Left 1080538787 11:33246795-33246817 CCCAAGTTGTACAGTTAACTGAG No data
Right 1080538792 11:33246828-33246850 CTCTTGTCAAAAGGCAAGAAAGG No data
1080538787_1080538790 1 Left 1080538787 11:33246795-33246817 CCCAAGTTGTACAGTTAACTGAG No data
Right 1080538790 11:33246819-33246841 ATTCTCCTTCTCTTGTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080538787 Original CRISPR CTCAGTTAACTGTACAACTT GGG (reversed) Intergenic
No off target data available for this crispr