ID: 1080540459

View in Genome Browser
Species Human (GRCh38)
Location 11:33258608-33258630
Sequence CGCCGCACTGGGAGAACTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080540451_1080540459 -8 Left 1080540451 11:33258593-33258615 CCGCCCGCTTCCCTTCGCCGCAC 0: 1
1: 0
2: 0
3: 16
4: 342
Right 1080540459 11:33258608-33258630 CGCCGCACTGGGAGAACTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1080540450_1080540459 17 Left 1080540450 11:33258568-33258590 CCGGCTTCTCTCGTTACGGTGGC 0: 1
1: 0
2: 1
3: 2
4: 42
Right 1080540459 11:33258608-33258630 CGCCGCACTGGGAGAACTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080540459 Original CRISPR CGCCGCACTGGGAGAACTGG CGG Intronic