ID: 1080549070

View in Genome Browser
Species Human (GRCh38)
Location 11:33353385-33353407
Sequence GGTGAACTATGCCACTGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080549070_1080549074 -10 Left 1080549070 11:33353385-33353407 CCATCCCAGTGGCATAGTTCACC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1080549074 11:33353398-33353420 ATAGTTCACCAAGTCCCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080549070 Original CRISPR GGTGAACTATGCCACTGGGA TGG (reversed) Exonic
901769211 1:11521933-11521955 GGTGGACTAGGGCACTGGGGTGG + Intronic
905402062 1:37710916-37710938 GCTGAACTATGTCACAGGGCTGG + Intergenic
912915059 1:113806689-113806711 TGTGAAGTATCCCACTGAGAAGG + Intronic
920898379 1:210080876-210080898 GGTGACAAATGCAACTGGGAAGG + Intronic
1065036040 10:21639538-21639560 TGTGAAGTATGTCACTGGGTAGG + Intronic
1070191934 10:74118962-74118984 GGTGCTCTCTGCCACTGGAAGGG + Exonic
1070337812 10:75470659-75470681 AGTGAGCTCTGGCACTGGGAAGG - Intronic
1074949566 10:118317952-118317974 TGGGAACTCTGCCTCTGGGAAGG - Intronic
1075328021 10:121550257-121550279 GGAGAACTCTGGCAATGGGAGGG - Intronic
1076897487 10:133320033-133320055 GGTGAGCTCTGCCCCAGGGACGG - Intronic
1077609807 11:3637230-3637252 GGTGAACTCTGGCAGAGGGAGGG + Intergenic
1079237926 11:18702746-18702768 GGTGAACCATGCCAAAGGAAGGG + Exonic
1080549070 11:33353385-33353407 GGTGAACTATGCCACTGGGATGG - Exonic
1086432388 11:86748279-86748301 GGCAGTCTATGCCACTGGGAAGG - Intergenic
1086952966 11:92909584-92909606 GGTGGTCTATGCCTGTGGGAAGG - Intergenic
1090869200 11:130727895-130727917 GGTGAGCTATTCCACTCGGATGG - Intergenic
1099490836 12:83286108-83286130 GGTGAAGCATGTCCCTGGGAAGG + Intergenic
1101205102 12:102478872-102478894 GGTGAGCTCTGCCTCTGGGCAGG + Intronic
1101217264 12:102596697-102596719 TGTGAGCTATGCCACTTGCAGGG - Intergenic
1103742302 12:123099109-123099131 GGGGAACTCAGCCCCTGGGATGG - Intronic
1104288514 12:127447237-127447259 GGTCAATGATGCTACTGGGATGG - Intergenic
1108084311 13:46769140-46769162 TGTTAACTATGTCACTGAGATGG + Intergenic
1112384187 13:98922550-98922572 CCTGAACTAAGCCTCTGGGAAGG - Intronic
1112759115 13:102672993-102673015 GATGAACTCTGCCAGTGTGAAGG + Intronic
1113801996 13:113091553-113091575 GGCAAACTGTGCCACAGGGAAGG - Intronic
1119280708 14:73405130-73405152 AGTTAACTATAACACTGGGATGG + Intronic
1119559556 14:75579149-75579171 GGTGAGCCAAGCCACTGGGTTGG - Exonic
1121028564 14:90636457-90636479 GTTGAAATCTACCACTGGGATGG - Intronic
1122914578 14:104852309-104852331 GGTGAACGAAGGCACTGAGAGGG - Intergenic
1124209723 15:27753018-27753040 GGTGAATCATCCCACAGGGATGG - Intergenic
1129776819 15:78242203-78242225 GGGGTGCTCTGCCACTGGGAAGG + Intronic
1132586820 16:709197-709219 GGTGAAGTATGCTCCTGGTAGGG - Intronic
1138311479 16:56027201-56027223 GATGGACGATGCCACTGGCAAGG + Intergenic
1141390144 16:83657782-83657804 GCTGAAGGATGCCACTGGCAGGG - Intronic
1141722818 16:85766257-85766279 GGGGAACTAAGCCACTGCCAGGG + Intergenic
1142557354 17:788634-788656 GGTGAGCTATGGCTCTGGGCAGG + Intronic
1142645770 17:1313003-1313025 GGTGAACATTCCCACTGGGGAGG - Intergenic
1142645836 17:1313247-1313269 GGTGAACATTCCCACTGGGGAGG - Intergenic
1142645854 17:1313314-1313336 GGTGAACATTCCCACTGGGGAGG - Intergenic
1142645886 17:1313422-1313444 GGTGAACATTCCCACTGGGGAGG - Intergenic
1142683642 17:1564175-1564197 GGTGGACTAGGACAGTGGGAGGG + Intergenic
1146803753 17:35848763-35848785 GGTCAAGTAGGCAACTGGGAGGG - Intronic
1146888066 17:36485655-36485677 GGTGATTTATGGCCCTGGGAGGG + Intergenic
1148486790 17:47995886-47995908 GCTGAACTAGGCAACTGGGAGGG + Intergenic
1150655406 17:67035953-67035975 GGTGACCTCCCCCACTGGGATGG - Intergenic
1155181340 18:23350813-23350835 GTTGAACTATCACACTGGGGAGG + Intronic
1162389393 19:10380282-10380304 AGTGAAGTTTGCAACTGGGAAGG + Intronic
1163084927 19:14972684-14972706 GGTGAGCTCTGCCTCTTGGAGGG - Exonic
1163291984 19:16384915-16384937 GGGCACCTATGCCACTGGGAAGG + Intronic
1163789392 19:19297594-19297616 GGTGAACAATGACAGTGTGATGG - Intronic
1165101059 19:33439044-33439066 GGAGAACTGTGCCACTGGCCTGG - Intronic
1166242799 19:41505453-41505475 TGTGAACCATATCACTGGGAGGG + Intergenic
1167649951 19:50723704-50723726 GGTGAACTGTGGGTCTGGGAGGG + Intronic
1167792341 19:51690000-51690022 GGTGAGCCGTGCCAGTGGGAGGG + Intergenic
1168697603 19:58413626-58413648 GGTGGACCATGCCACTCGGGAGG - Intronic
925918403 2:8623417-8623439 GGTGAGCCATGCATCTGGGAAGG - Intergenic
927562325 2:24082910-24082932 GGTGAGCCAGGCCTCTGGGATGG + Exonic
930339675 2:50096796-50096818 CATGAAATATGACACTGGGAAGG + Intronic
938062500 2:128264142-128264164 GATGACCTTTGTCACTGGGATGG + Intronic
938062514 2:128264202-128264224 GGTGACCTTTGTCACTGGGATGG + Intronic
941602107 2:167555983-167556005 TATGAATTATGCCAATGGGATGG + Intergenic
947794438 2:232885206-232885228 GGTGATCTGTGCCTCTGGGGCGG + Intronic
1170549725 20:17466471-17466493 GGTGGATTTTGCCACTTGGAGGG + Intronic
1171055578 20:21903321-21903343 GGTATGCTATTCCACTGGGATGG + Intergenic
1175210626 20:57351630-57351652 GGGGAACTGAGCCTCTGGGAAGG + Intronic
1175853092 20:62104277-62104299 GGGGACCGATGCCACTGGGGCGG + Intergenic
1176428441 21:6562518-6562540 GGTGACCTCTGTCACCGGGAGGG - Intergenic
1179703931 21:43170834-43170856 GGTGACCTCTGTCACCGGGAGGG - Intronic
950150687 3:10684819-10684841 GGTGATCTTTGCCAATTGGATGG + Intronic
951405785 3:22295854-22295876 GATCAACAATGCCATTGGGAGGG - Intronic
953912598 3:46900457-46900479 GGTGAGCTGTGCCTCTGGGAAGG - Intronic
954698939 3:52441754-52441776 GCTGGCCTATGTCACTGGGAAGG - Intronic
962628771 3:137254550-137254572 TGTGAACTATGCATCTGAGAAGG + Intergenic
963919629 3:150893159-150893181 GCTGGATTCTGCCACTGGGAAGG - Intronic
965494851 3:169385147-169385169 GATAAGCTATGCCAGTGGGAGGG - Intronic
967934003 3:194711974-194711996 GTTGAAATAGGCCACTGGGCTGG - Intergenic
969227518 4:5808431-5808453 GGTCAACGATGCCACAGGCAGGG - Intronic
969883187 4:10192592-10192614 GATGAAGTATGCCACTGTTAGGG + Intergenic
971519525 4:27531492-27531514 GGTGAGCTCTGGGACTGGGAGGG + Intergenic
978547703 4:109890384-109890406 GGGAAATTAGGCCACTGGGAAGG - Intergenic
978634322 4:110785679-110785701 GCTGAAGTTTGCCACTGGGACGG - Intergenic
980727399 4:136781972-136781994 ATTGAATTATGCCTCTGGGAAGG - Intergenic
985532515 5:442564-442586 TGGGAACAATGCCAGTGGGATGG - Exonic
986129123 5:4910650-4910672 TCTCAACTATGCCTCTGGGATGG + Intergenic
998059271 5:139106282-139106304 GGTGGAGGATGCCAGTGGGAAGG - Intronic
1000900445 5:166905749-166905771 GGTGCAGTAAGCCACTTGGAAGG + Intergenic
1001026404 5:168227941-168227963 GGTGATGTATGCTAATGGGATGG + Exonic
1004593237 6:17073812-17073834 TGTAAACAAAGCCACTGGGAAGG + Intergenic
1006512776 6:34530531-34530553 GCTGACCAATGCCACTGGGGCGG + Exonic
1009228424 6:61037776-61037798 GGGGAACTATATCACGGGGAGGG + Intergenic
1011519330 6:88187311-88187333 GTTAAACTATTCCACTGGCATGG + Intergenic
1012658319 6:101854160-101854182 GGTAAACTAGGCCTCTAGGAGGG + Intronic
1014097682 6:117478521-117478543 GCTGAGCTCTGCCACAGGGAGGG + Intronic
1014388269 6:120828372-120828394 GCTGAACTATCCCACAGTGATGG + Intergenic
1015427108 6:133083573-133083595 GATTAACTATTTCACTGGGATGG + Intergenic
1017295522 6:152789482-152789504 GGTAAAGCATGCCACTGTGAGGG - Intergenic
1017940231 6:159046391-159046413 GGTGAACTCTGGCACTGTGGTGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1026669952 7:72381543-72381565 GCTCAACTATGCCCCTGCGAAGG - Intronic
1027255921 7:76430795-76430817 GATGAGCCATGCCCCTGGGAGGG + Intronic
1028043395 7:86087724-86087746 CGTGAACTATGCATCTGTGATGG + Intergenic
1029570717 7:101366995-101367017 AGTTAACTACACCACTGGGAAGG - Intronic
1032342948 7:131092975-131092997 TGTGACCTATGCCACTCTGAAGG - Intergenic
1032747863 7:134806151-134806173 GGGAAACTATGCCATGGGGATGG - Intronic
1035039985 7:155920363-155920385 TGTGAACAATGCCCCTGGGGAGG - Intergenic
1037516694 8:19638787-19638809 GCTGAACTAGGCCTGTGGGAAGG + Intronic
1038024345 8:23575672-23575694 GGTGAGCCAAGCCAGTGGGAGGG - Intergenic
1039036990 8:33370756-33370778 GGTGATTTATGCCTCTGGCAAGG - Intergenic
1042627145 8:70770687-70770709 TGTAAACAAAGCCACTGGGAAGG - Intronic
1048966632 8:139619397-139619419 CTTGCACTATGCCACTGAGAGGG + Intronic
1050290765 9:4152045-4152067 GGTGAGATATGAGACTGGGAGGG - Intronic
1055988813 9:82083195-82083217 GGTAAACACTGCCACTGGGTTGG - Intergenic
1062123594 9:134847773-134847795 GGTGACCAGGGCCACTGGGAAGG + Intergenic
1185728508 X:2442614-2442636 GGGGACCTGTGGCACTGGGAAGG - Intronic
1185878141 X:3715794-3715816 GCTGAACTCTGCCATTCGGAAGG + Intergenic
1187741887 X:22365182-22365204 GGGGAACCAAGCCACTAGGAGGG - Intergenic
1192808226 X:74528505-74528527 GGGGAACCAAGCCACTGGGAAGG - Intronic
1193312964 X:80028906-80028928 GGTGAAATATTTCACTGGAATGG + Intronic
1197071262 X:122300360-122300382 GGTGAACAAAGCCACCAGGAAGG - Intergenic