ID: 1080550750

View in Genome Browser
Species Human (GRCh38)
Location 11:33372067-33372089
Sequence CCTAGAGTCTAGAACGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080550747_1080550750 -4 Left 1080550747 11:33372048-33372070 CCTTGCTTGCTGTGGGAATCCTA No data
Right 1080550750 11:33372067-33372089 CCTAGAGTCTAGAACGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080550750 Original CRISPR CCTAGAGTCTAGAACGGTCC TGG Intergenic
No off target data available for this crispr