ID: 1080551270

View in Genome Browser
Species Human (GRCh38)
Location 11:33375950-33375972
Sequence TGCGCGGGAGCCGCCGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080551260_1080551270 -6 Left 1080551260 11:33375933-33375955 CCCTTAAGGACCTCCGCTGCGCG No data
Right 1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG No data
1080551259_1080551270 -5 Left 1080551259 11:33375932-33375954 CCCCTTAAGGACCTCCGCTGCGC No data
Right 1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG No data
1080551258_1080551270 -2 Left 1080551258 11:33375929-33375951 CCTCCCCTTAAGGACCTCCGCTG No data
Right 1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG No data
1080551257_1080551270 -1 Left 1080551257 11:33375928-33375950 CCCTCCCCTTAAGGACCTCCGCT No data
Right 1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG No data
1080551261_1080551270 -7 Left 1080551261 11:33375934-33375956 CCTTAAGGACCTCCGCTGCGCGG No data
Right 1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080551270 Original CRISPR TGCGCGGGAGCCGCCGGGAG GGG Intergenic
No off target data available for this crispr