ID: 1080553923

View in Genome Browser
Species Human (GRCh38)
Location 11:33398648-33398670
Sequence TCTTCTAACTAGGTTATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080553923_1080553930 24 Left 1080553923 11:33398648-33398670 CCATTCATAACCTAGTTAGAAGA No data
Right 1080553930 11:33398695-33398717 AGTCTAACACAACCATTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080553923 Original CRISPR TCTTCTAACTAGGTTATGAA TGG (reversed) Intergenic