ID: 1080553930

View in Genome Browser
Species Human (GRCh38)
Location 11:33398695-33398717
Sequence AGTCTAACACAACCATTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080553924_1080553930 14 Left 1080553924 11:33398658-33398680 CCTAGTTAGAAGAAGAAAAATCG No data
Right 1080553930 11:33398695-33398717 AGTCTAACACAACCATTGATAGG No data
1080553923_1080553930 24 Left 1080553923 11:33398648-33398670 CCATTCATAACCTAGTTAGAAGA No data
Right 1080553930 11:33398695-33398717 AGTCTAACACAACCATTGATAGG No data
1080553926_1080553930 -10 Left 1080553926 11:33398682-33398704 CCATAGCCCCAAGAGTCTAACAC No data
Right 1080553930 11:33398695-33398717 AGTCTAACACAACCATTGATAGG No data
1080553925_1080553930 -9 Left 1080553925 11:33398681-33398703 CCCATAGCCCCAAGAGTCTAACA No data
Right 1080553930 11:33398695-33398717 AGTCTAACACAACCATTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080553930 Original CRISPR AGTCTAACACAACCATTGAT AGG Intergenic