ID: 1080569321

View in Genome Browser
Species Human (GRCh38)
Location 11:33542103-33542125
Sequence GTCCCCCTTTAGGCCCCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080569321_1080569324 -1 Left 1080569321 11:33542103-33542125 CCAACCGGGGCCTAAAGGGGGAC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080569321 Original CRISPR GTCCCCCTTTAGGCCCCGGT TGG (reversed) Intronic
900146859 1:1162316-1162338 GACCCCCCGTAGGCCCAGGTGGG - Intergenic
908981321 1:69962806-69962828 GTCCTCCAGTAGGCCCCAGTGGG - Intronic
912537326 1:110384577-110384599 GTTCCCCTCTAGACCCCTGTGGG - Intronic
913870579 1:123954432-123954454 GACCCCTTTTAGGCCCTCGTTGG + Intergenic
920535061 1:206731873-206731895 GTCCTCCTTCAGGACCCGGCTGG - Exonic
923847517 1:237752279-237752301 GTGCACCTGTAGGCCCAGGTGGG - Intronic
1062903540 10:1163722-1163744 GTCCCACTTGTGGCCCCAGTCGG + Intergenic
1068118572 10:52761216-52761238 GGCCTCCCTTAGGCCCAGGTAGG + Intergenic
1072651453 10:97299003-97299025 GTCCTGCTTTAGGCCCAGCTAGG - Intergenic
1073088410 10:100911515-100911537 CTTCCCCTTTAGTCCCCGGGAGG - Intergenic
1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1086741888 11:90379384-90379406 GTATCCCTTCAGGCCCCAGTTGG + Intergenic
1091547992 12:1517284-1517306 GTCCCCCTGTAGACCCCCCTGGG - Intergenic
1102772879 12:115493880-115493902 GACCCCCTCTTGGCCCCGGGGGG - Intergenic
1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG + Intergenic
1111496840 13:89061998-89062020 GCTCCCTCTTAGGCCCCGGTGGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114524045 14:23357162-23357184 GCCCCCCTTTAGGCCTTGGGTGG - Exonic
1119750001 14:77070445-77070467 GGCCCCCTTTAGGCTCTGCTGGG - Intergenic
1119867317 14:77984620-77984642 ATCCCCCTTGGGGTCCCGGTGGG - Intergenic
1122924680 14:104894157-104894179 TTTCCCCCTTAGGCCCAGGTGGG + Intronic
1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130468533 15:84204802-84204824 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130495731 15:84468740-84468762 GGCCCCCTGCAGGGCCCGGTGGG - Intergenic
1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1131188538 15:90294812-90294834 GGCCCCCTGCAGGGCCCGGTGGG - Intronic
1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG + Intronic
1140202062 16:72902876-72902898 GTCCAACTTTAGCCCCCGGCTGG - Intronic
1140743272 16:77960437-77960459 GTGCCCCTTCAGGCCCAGGGTGG - Intronic
1154299753 18:13182765-13182787 GTCCCCCTCTAGGCTCAGATGGG - Intergenic
1156480347 18:37432336-37432358 CTCCCCCTCTGGGCCCAGGTGGG - Intronic
1162555508 19:11383576-11383598 GGCCCCCTATCGGCCCCGGCAGG + Intronic
1165496133 19:36152665-36152687 GTACCGCTTTGGGCTCCGGTGGG - Exonic
1166380307 19:42352201-42352223 GTCCCCCTGTAGGCACCTGCAGG - Exonic
932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG + Intergenic
949008594 2:241665635-241665657 GTCCCACTGCAGGCCCCGGATGG - Intronic
1176123085 20:63462795-63462817 GTCCCCCTCTAGGCTCCGTCGGG - Intronic
1180847524 22:18992107-18992129 CTCCCCCTTCAGCCCCCTGTGGG + Intergenic
1180850712 22:19018690-19018712 GTCTGCATTTAGGCCCCTGTGGG - Intergenic
1184649257 22:45912242-45912264 GTCGCCCTTCAGGCCTCAGTGGG - Intergenic
950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG + Intronic
955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG + Intergenic
966296296 3:178427580-178427602 GCCCATCTTTAGGCCCCGGATGG + Intronic
969685858 4:8673731-8673753 GTCCCCCTCTGGGCCTCCGTTGG + Intergenic
985537125 5:471871-471893 GTCCCCATTGAGTCCCTGGTGGG - Exonic
998411490 5:141914613-141914635 CTGCCCCTTTAGGCCCCGCGTGG - Intergenic
1005947097 6:30602669-30602691 GTCCCCATGGAGGCCCTGGTGGG - Exonic
1009241711 6:61193459-61193481 CTCCCCCTTTAGGCCTGGGATGG - Intergenic
1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG + Intergenic
1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG + Intergenic
1030273678 7:107696795-107696817 GTTCCCCTCTAGGCCCAGGAGGG - Intronic
1032081884 7:128863205-128863227 GTCCCCGTTTGGGGCTCGGTGGG + Intronic
1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG + Intronic
1051607367 9:18928727-18928749 CTCCCCCATCAGGCCCCGGTAGG + Exonic
1056846249 9:90040471-90040493 GTCCTCCTTTAGGGCCCAGGAGG - Intergenic
1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG + Exonic
1190222378 X:48520685-48520707 ATCCCCCTCTAGGCCCCAGCAGG - Exonic
1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG + Intergenic
1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG + Intronic
1200143530 X:153913745-153913767 GTCTCCCTCTAACCCCCGGTGGG + Intronic