ID: 1080569321

View in Genome Browser
Species Human (GRCh38)
Location 11:33542103-33542125
Sequence GTCCCCCTTTAGGCCCCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080569321_1080569324 -1 Left 1080569321 11:33542103-33542125 CCAACCGGGGCCTAAAGGGGGAC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080569321 Original CRISPR GTCCCCCTTTAGGCCCCGGT TGG (reversed) Intronic