ID: 1080569324

View in Genome Browser
Species Human (GRCh38)
Location 11:33542125-33542147
Sequence CAAGAAGCAGCCGATGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080569309_1080569324 24 Left 1080569309 11:33542078-33542100 CCAAGGATTCTACCGAGTCCCTG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1080569315_1080569324 6 Left 1080569315 11:33542096-33542118 CCCTGGTCCAACCGGGGCCTAAA 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1080569313_1080569324 12 Left 1080569313 11:33542090-33542112 CCGAGTCCCTGGTCCAACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 105
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1080569308_1080569324 28 Left 1080569308 11:33542074-33542096 CCTTCCAAGGATTCTACCGAGTC 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1080569322_1080569324 -5 Left 1080569322 11:33542107-33542129 CCGGGGCCTAAAGGGGGACAAGA 0: 1
1: 0
2: 3
3: 10
4: 112
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1080569321_1080569324 -1 Left 1080569321 11:33542103-33542125 CCAACCGGGGCCTAAAGGGGGAC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1080569316_1080569324 5 Left 1080569316 11:33542097-33542119 CCTGGTCCAACCGGGGCCTAAAG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080569324 Original CRISPR CAAGAAGCAGCCGATGTGTC AGG Intronic
900510448 1:3057104-3057126 CAAGAATCAGCAGATGCCTCAGG + Intergenic
908112293 1:60909347-60909369 AAAGAAGCAGCCGAAGTGGTGGG - Intronic
916310059 1:163388316-163388338 CAAAAAGCTGCAGAAGTGTCTGG - Intergenic
916490335 1:165296703-165296725 CAAGAAACAGCAGATGTGAGAGG - Intronic
920278996 1:204829178-204829200 CAAGAAGGGGCTGATGTGTGCGG - Intronic
920694744 1:208173865-208173887 CAAGCAGCAGCAGATGTTGCTGG - Intronic
922363951 1:224846414-224846436 CAAGCAGTACCAGATGTGTCAGG + Intergenic
923176918 1:231475603-231475625 AAAGAAGGAGCCAATGTGTGTGG - Intergenic
923973125 1:239227355-239227377 CAATAAGCAGCCTGTGTGACTGG - Intergenic
924402190 1:243696637-243696659 CAAGAAGAAGCTGATTTGTAGGG - Intronic
1063786213 10:9386780-9386802 CAGGACTCAGCTGATGTGTCAGG - Intergenic
1064139583 10:12779018-12779040 CAAGAAGCAGCCCGTGACTCTGG - Intronic
1064826347 10:19406981-19407003 CAGGAAGCAGCACATGTGTTTGG - Intronic
1066430164 10:35343781-35343803 CAAGAAGCAGGATATGTGTGTGG + Intronic
1066489712 10:35882934-35882956 CAAGCAGCAACCTCTGTGTCAGG + Intergenic
1073108225 10:101045405-101045427 CAAGAAGCTGCAGATGTGAAGGG - Intergenic
1073812460 10:107165027-107165049 CCCGGAGCAGTCGATGTGTCGGG + Intergenic
1076289915 10:129337482-129337504 AAAGAAGCAGAGGATGGGTCTGG + Intergenic
1076765585 10:132631240-132631262 CAAGGCGCAGCCGATGGGACCGG - Intronic
1076989357 11:262664-262686 TAAAAAGCAGCAGATTTGTCAGG + Intergenic
1080569324 11:33542125-33542147 CAAGAAGCAGCCGATGTGTCAGG + Intronic
1084416952 11:69037977-69037999 CAAGAGGAAGCCGCTGTGTTGGG + Intergenic
1087929957 11:103965826-103965848 CAAGAGGCTGTCGAAGTGTCAGG - Intronic
1088452241 11:109994617-109994639 CAAGCAGCAGCCAGTGTGGCTGG - Intergenic
1089480969 11:118804811-118804833 TAAGAAGCAGCAGCTGTGTGAGG - Intergenic
1090941730 11:131393295-131393317 CATGAAGGAGCCCATGTGTGGGG - Intronic
1091291235 11:134441029-134441051 CAAGATGCAGCCCAAGTCTCTGG + Intergenic
1091695663 12:2626478-2626500 CAAGCAGCATCAGATGTGGCTGG - Intronic
1092065826 12:5589018-5589040 CAAGAGGCAGCAGATGTGAAGGG + Intronic
1092248244 12:6875746-6875768 CAAGAAGCAGCAGGTGGGTTTGG + Intronic
1092513487 12:9183664-9183686 CAGGCAGCAGCCAATGTGCCCGG + Intronic
1092988739 12:13874215-13874237 CAAGAAGGAGCCCAGGTGACAGG - Intronic
1094661652 12:32475016-32475038 AAAAAAGCAGCAGATGTGACTGG + Intronic
1097117025 12:56705075-56705097 CAAGCATGAGCCAATGTGTCTGG + Intergenic
1101442575 12:104714615-104714637 CGTCAAGCAGCCGCTGTGTCTGG - Intronic
1102234906 12:111288235-111288257 TAAGAAGAAGCCAATGTGACTGG + Intronic
1105003148 12:132704089-132704111 AAAGTAGCAGCCCATGTGTCTGG - Intronic
1109960319 13:69620773-69620795 CAGAAAGCAGCCAGTGTGTCTGG + Intergenic
1110474463 13:75897670-75897692 CACGAAGCAGGCTATGTTTCTGG + Intergenic
1113265059 13:108607733-108607755 CAAGAGGCAGTGGAGGTGTCGGG - Intronic
1117322893 14:54640872-54640894 CAAGATGCAGCCTGTGTGTAAGG - Intronic
1117436192 14:55717149-55717171 CTAGAAGCAGCCACTGTGTGAGG - Intergenic
1123012764 14:105357283-105357305 CAAGCAGCAGACGATGTGGCTGG - Intronic
1125791093 15:42366315-42366337 CAAAAACCAGCCGGTGTGGCTGG - Intronic
1126026211 15:44448364-44448386 CAAGATGCAGCACATGGGTCTGG - Intronic
1128074929 15:64820060-64820082 CAAGCAGCAGGCCATGGGTCAGG + Intronic
1132387621 15:101411542-101411564 CAAGAAGCAGCCCATGTTTGAGG + Intronic
1132614876 16:835475-835497 CCAGAAGCAGCCCCTGTGTCTGG - Intergenic
1132686415 16:1163999-1164021 CGAGGAGCAGCCGATGGGTGCGG + Intronic
1134242814 16:12518349-12518371 CAGGAGGCAGCCGGTGTGGCTGG - Intronic
1134544500 16:15097345-15097367 CAGGCAGGAGCCGCTGTGTCTGG - Intronic
1134657523 16:15958434-15958456 CAAGAAGCAGACCAGGTGTGAGG - Intronic
1137269619 16:46894632-46894654 CCAGACGCAGCCACTGTGTCTGG - Intronic
1137651560 16:50124840-50124862 CAGGAAGGAGCCGCTGTGCCTGG + Intergenic
1139874986 16:70138628-70138650 CAGGCATCAGCCAATGTGTCTGG + Intronic
1140360799 16:74342503-74342525 CAGGCATCAGCCAATGTGTCTGG - Intergenic
1141112109 16:81278351-81278373 TAAGAAGCCACCGATGTGCCAGG + Intronic
1148109367 17:45136082-45136104 CAAGAAGCAGCCTTCGTGTGAGG - Intronic
1148153367 17:45409501-45409523 CCAGAAGCAGCCTGTGTCTCTGG - Intronic
1149500598 17:57149441-57149463 CACGAAGCAGCAGATGTGCCTGG - Intergenic
1162080585 19:8215496-8215518 AAACAAGCAGCGGGTGTGTCTGG + Intronic
1163314910 19:16535268-16535290 TGAGAAGCAGCCTCTGTGTCTGG + Intronic
924966962 2:86269-86291 CCCAAAGCAGCCGATGTGTAAGG + Intergenic
925562259 2:5209848-5209870 CATGATGCAGCCCATGAGTCAGG + Intergenic
927827097 2:26316620-26316642 CTCGAAGCAGCAGATGTCTCGGG + Intronic
933741196 2:85535572-85535594 CAAGAAGCTGTTGATGTGGCAGG - Intergenic
938671330 2:133589211-133589233 CAAGTAGCAGTGGAGGTGTCAGG + Intergenic
939017696 2:136920816-136920838 CCAGAAGGAGCCGAAGTGGCAGG + Intronic
1171467157 20:25337621-25337643 CAAGAACCAGCTCATGTGCCTGG + Intronic
1172515036 20:35527532-35527554 CATGAGGCAGCTCATGTGTCTGG + Intronic
1175242039 20:57556841-57556863 CAAGATGCAGCAGGTGTGACCGG - Intergenic
1181338170 22:22157061-22157083 CAGGCAGCAGCCGCTCTGTCAGG - Intergenic
1184045365 22:41969642-41969664 CAAGAAGGATCCAGTGTGTCTGG - Intergenic
1184525912 22:45022504-45022526 CAAGAAACAACAGATGTGGCTGG - Intergenic
949265119 3:2148179-2148201 CAAGAAGCAGCATATGTTTAAGG - Intronic
950150668 3:10684682-10684704 AAAGAAGCATCCAATATGTCCGG + Intronic
952236492 3:31485989-31486011 CAGGAAGCAGCCGCTCTGACTGG - Intergenic
954201648 3:49026764-49026786 CAAGAAACAGCTGCTGTGTGGGG - Exonic
960841230 3:121961881-121961903 CTAGAAGCAGCTGGTGTGTGTGG + Intergenic
961171598 3:124801417-124801439 CAAGAAGCAGGAGAGGTGGCAGG - Intronic
962221793 3:133570679-133570701 CAAGTAGGAGCCGCTGTGCCCGG - Intergenic
963731040 3:148972901-148972923 CAAGCAGAAGCCGATGTCACTGG - Intergenic
964866931 3:161272265-161272287 TAAGAAGCAGCAGATGGGCCGGG - Intergenic
965767699 3:172148351-172148373 AAAGAAGCAGCCAATGTGGAGGG + Intronic
966284151 3:178273540-178273562 TAAGAAGCAGTAGATTTGTCAGG - Intergenic
974199584 4:58621951-58621973 CTAGAAGCAGCTAATGTGTGTGG + Intergenic
976568755 4:86584290-86584312 TAAGCAGCAGCAGACGTGTCAGG + Intronic
976596155 4:86897081-86897103 CAGGAATGAGCCGCTGTGTCTGG - Intronic
977089819 4:92656740-92656762 CAAGAAGCAGCACATTTCTCAGG - Intronic
978238979 4:106492790-106492812 CTAGAAGCAGCTCATGTGTGTGG - Intergenic
982072641 4:151708853-151708875 AAAGAAGCAGGCAATGTGTGGGG + Intronic
984308823 4:178030274-178030296 CAAGAAGCATCCTATCTCTCTGG + Intergenic
985759101 5:1735673-1735695 GAACAAGCAGCTGATGTGGCTGG + Intergenic
991238965 5:64434348-64434370 GAAGCAGCAGCCAATGTGACTGG + Intergenic
992522053 5:77564274-77564296 CAGGAATGAGCCGCTGTGTCTGG - Intronic
993461457 5:88188391-88188413 CAAGAATGAGCCAATGTGCCTGG + Intergenic
997758702 5:136424068-136424090 GAAGAAGCAGCAGCTGTGTCTGG + Intergenic
998900427 5:146847486-146847508 TTAGAAGCAGCAGGTGTGTCTGG + Intronic
999591215 5:153148523-153148545 CAAGTTGCAGCCAATGTGGCTGG - Intergenic
1003194552 6:3903175-3903197 CAGGAAGCAGCTGATGGCTCTGG + Intergenic
1007507958 6:42351655-42351677 CAAGAAGCAGCTGCTCAGTCAGG + Intronic
1007732206 6:43954166-43954188 GCAGATGCAGCCGTTGTGTCTGG - Intergenic
1023630511 7:42159189-42159211 CAAGAAGCAGCCTAAGTATTTGG + Intronic
1026761481 7:73129998-73130020 AAAGAAGCAGCAGCTGTGTGTGG - Intergenic
1027037822 7:74938809-74938831 AAAGAAGCAGCAGCTGTGTGTGG - Intergenic
1027085740 7:75262662-75262684 AAAGAAGCAGCAGCTGTGTGTGG + Intergenic
1027537359 7:79420623-79420645 CAAGAAGCCACTGATGAGTCAGG + Intronic
1029219928 7:98980563-98980585 CATGGAGCAGCCGATGAGCCTGG - Intronic
1029244618 7:99189968-99189990 CAAGAAGCAGCTGCTGTGTTTGG - Intronic
1032790465 7:135238662-135238684 TAAGGAGCAACAGATGTGTCTGG - Intronic
1035546127 8:483638-483660 CAGGAAGCAGCCGTGGTATCTGG + Intergenic
1035675840 8:1455065-1455087 CAAGGAGCTGATGATGTGTCTGG - Intergenic
1035918103 8:3647023-3647045 CAAGAAGCACCAGAAGTGGCAGG - Intronic
1036152104 8:6308321-6308343 CAAGAAGCAGCTGAGCTGTGAGG - Intergenic
1044955654 8:97476739-97476761 CCAGATGCAGCCAATGTGGCTGG - Intergenic
1052626211 9:30980571-30980593 CTAGAAGCAGCCAGTGTGTATGG + Intergenic
1057169792 9:92954812-92954834 CAAGATGCAGCTGAGGTGGCTGG - Intronic
1059191652 9:112333226-112333248 TAGGAAGCAGCGGACGTGTCCGG + Intronic
1059852918 9:118363967-118363989 CAAGAAGCAGCAGCGGGGTCAGG + Intergenic
1186407380 X:9316090-9316112 CAAGAAGCAGCCTCTTTGTGGGG - Intergenic
1188983368 X:36748576-36748598 CTAGAAGCAGCTAATGTGTGTGG - Intergenic
1196563133 X:117174258-117174280 CAGGAAGCAGCCAATATTTCTGG - Intergenic
1198091315 X:133333291-133333313 CAAGAAGCAATGGATCTGTCTGG - Intronic
1198467611 X:136917493-136917515 CGAAAAGGAGCCTATGTGTCAGG - Intergenic
1198939364 X:141935885-141935907 CAACAAGCAGCCAATATTTCTGG - Intergenic