ID: 1080569492

View in Genome Browser
Species Human (GRCh38)
Location 11:33543034-33543056
Sequence GTCCCAGTTGATGGTGATGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080569492 Original CRISPR GTCCCAGTTGATGGTGATGC GGG (reversed) Exonic
900925710 1:5704991-5705013 ACCCCAGCTGATGCTGATGCTGG - Intergenic
901272496 1:7963493-7963515 ATCCCAGCTGAGGGTGAGGCAGG - Intronic
901581583 1:10248546-10248568 GTCCCAGTATCTGGTGTTGCAGG - Intronic
902078191 1:13803753-13803775 GACCCAGTTGATAGGGAGGCTGG - Intronic
902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG + Intergenic
902722734 1:18314932-18314954 GGCCCAGCTGATGGAGGTGCAGG + Intronic
902761673 1:18584927-18584949 GTTCCAGCAGATGGTGCTGCAGG - Intergenic
905804963 1:40869609-40869631 GTCCCAGCTGCTGGAGAGGCTGG + Intergenic
906151598 1:43591020-43591042 GTCCCAGGTGAGGGTGACACTGG - Exonic
906721467 1:48008460-48008482 ATCCATGTTGAAGGTGATGCAGG - Intergenic
906723412 1:48025713-48025735 TTCCCAGATGATGGTGATGATGG + Intergenic
907316604 1:53576526-53576548 GGCCCAGTGGATGGGGAGGCGGG - Intronic
908054672 1:60271428-60271450 TTCCCACGTGATGCTGATGCAGG + Intergenic
908244760 1:62219084-62219106 GTCCCAGTTACTGGGGAGGCTGG - Intergenic
911325148 1:96462555-96462577 GTCCCAGCTGTTGGGGAGGCTGG - Intergenic
912984508 1:114413907-114413929 GTCCCAGTTACTGGGGATACTGG + Intronic
913127821 1:115809591-115809613 GTCCCATTTGCTGTTGTTGCTGG + Intergenic
915220897 1:154373644-154373666 GTCCCAGCTGCTGGGGAGGCAGG - Intergenic
916019526 1:160779870-160779892 CTCCCAGGTGAGGGTGCTGCAGG + Intergenic
917606998 1:176641806-176641828 GACCAAGTTGATGATGAGGCTGG - Intronic
917748712 1:178035794-178035816 GTGCCAGGTGATACTGATGCTGG - Intergenic
918140927 1:181719266-181719288 GTGACAGTTCATGGTGATGTAGG - Intronic
918434301 1:184495568-184495590 ATGCTATTTGATGGTGATGCTGG - Intronic
920838903 1:209537406-209537428 GTCCAAGGTGATTGAGATGCAGG + Intergenic
923642554 1:235779484-235779506 TTCCTAGGTGATGCTGATGCTGG - Intronic
1066604849 10:37154369-37154391 TTCTCAGGTGATGCTGATGCTGG + Intronic
1066605330 10:37161139-37161161 TTCTCAGGTGATGCTGATGCTGG + Intronic
1066606390 10:37178463-37178485 TTCTCAGGTGATGCTGATGCTGG + Intronic
1066607172 10:37190264-37190286 TTCTCAGGTGATGCTGATGCTGG + Intronic
1066607926 10:37202023-37202045 TTCTCAGGTGATGCTGATGCTGG + Intronic
1068963318 10:62886954-62886976 TTCCCAGGTGATGCCGATGCTGG + Intronic
1069601676 10:69712098-69712120 TTCCCAGGTCATGTTGATGCAGG + Intergenic
1069721203 10:70550422-70550444 CTCCCAGATGATACTGATGCTGG + Intronic
1070727472 10:78802258-78802280 GTCCAAGGGGAGGGTGATGCTGG + Intergenic
1071547511 10:86539623-86539645 CACCCAGTTGCTGGTGAGGCTGG - Intergenic
1072047349 10:91670283-91670305 CTCTCAGATGATGCTGATGCTGG + Intergenic
1074156341 10:110803525-110803547 GTCCCAGGAGATGCTGCTGCTGG + Intronic
1074931730 10:118133088-118133110 TCCCCAGGTGATGCTGATGCTGG - Intergenic
1075188847 10:120287603-120287625 CTCCCAGCTGATGTTGCTGCTGG + Intergenic
1075678248 10:124312751-124312773 GTCCAAGTTCAAGGTGTTGCTGG + Intergenic
1075848539 10:125567243-125567265 GTCCATATTGATGGTAATGCTGG + Intergenic
1075942323 10:126401542-126401564 CTCCCAAATGATGCTGATGCTGG - Intergenic
1076838730 10:133034108-133034130 GTCCCAGTGGAGGGAGATGCAGG + Intergenic
1079015743 11:16867193-16867215 CTTCCAGTTGATTCTGATGCAGG - Intronic
1080132938 11:28817853-28817875 CTGCCAGTTGAAGGTAATGCTGG - Intergenic
1080569492 11:33543034-33543056 GTCCCAGTTGATGGTGATGCGGG - Exonic
1082657935 11:55874048-55874070 ATGCCAGGTGATGCTGATGCAGG + Intergenic
1084278639 11:68071238-68071260 GTCCCAGCTGATGGAGGAGCTGG - Intronic
1085548488 11:77344107-77344129 CTCCCAGATGATGATGATGCTGG - Intronic
1086715144 11:90053198-90053220 AGCCCAGTTGATGCTGACGCAGG + Intergenic
1087768576 11:102182153-102182175 TTCCCAGGTGGTGCTGATGCCGG - Intronic
1088817032 11:113428469-113428491 CTCCCAGTAGATGGGGATGAGGG + Intronic
1089832763 11:121343269-121343291 GTCCCAGCTGAGGCTGAGGCAGG - Intergenic
1090594858 11:128310355-128310377 GCCCCAGTTGATTGAGATGTTGG - Intergenic
1093063018 12:14627249-14627271 ATCCCAGGGGATGATGATGCAGG - Intronic
1093508900 12:19903485-19903507 GTCCCAGTTATTGGGGAGGCTGG - Intergenic
1093672046 12:21888522-21888544 CTCCCAGTTGATGCTGATGCTGG - Intronic
1097009759 12:55944354-55944376 GTCCCAGCTGAGGCTGAGGCGGG + Intronic
1097321871 12:58234520-58234542 GTCTCTGTTGATGGTGATGTAGG - Intergenic
1098014372 12:66088724-66088746 GCCCCAGTTGTTGTTGAAGCTGG + Intergenic
1100169042 12:91952052-91952074 ATCCCAGTTGCTGGAGAGGCCGG + Intergenic
1100410077 12:94307858-94307880 GTCCCAGTTGATAGTGAAGAAGG - Exonic
1103890496 12:124235120-124235142 GACCCTGATGATGGTGATGGTGG - Intronic
1104624039 12:130338263-130338285 GTCCCAGGTGCGGGGGATGCAGG + Intronic
1104624052 12:130338305-130338327 GTCCCAGGTGCGGGAGATGCAGG + Intronic
1104624066 12:130338347-130338369 GTCCCAGGTGTGGGAGATGCAGG + Intronic
1104624094 12:130338431-130338453 GTCCCAGGTGCGGGAGATGCAGG + Intronic
1104624108 12:130338473-130338495 GTCCCAGGTGTGGGAGATGCAGG + Intronic
1104624135 12:130338557-130338579 GTCCCAGGTGTGGGAGATGCAGG + Intronic
1104624151 12:130338599-130338621 GTCCCAGGTGCGGGGGATGCAGG + Intronic
1104624165 12:130338641-130338663 GTCCCAGGTGTGGGAGATGCAGG + Intronic
1104624181 12:130338683-130338705 GTCCCAGGTGCGGGGGATGCAGG + Intronic
1104864720 12:131946197-131946219 GTCCCAGTTGCTTGGGACGCCGG - Intergenic
1106874408 13:34055972-34055994 TTCCCAGGTGATCCTGATGCTGG + Intergenic
1108463959 13:50695752-50695774 GTCTGTGTTGATGTTGATGCTGG + Intronic
1108697134 13:52912465-52912487 TTCCCAGTTGAGGGAGATGTTGG + Intergenic
1113444844 13:110357137-110357159 GACTCTGGTGATGGTGATGCGGG + Intronic
1114553217 14:23546237-23546259 ATTCCAGTTGATGGTCCTGCTGG + Intronic
1115196887 14:30811218-30811240 GTCCCAGTTGCTTGGGAGGCTGG - Intergenic
1115397174 14:32921450-32921472 TTCCCAGGTGATGATAATGCTGG + Intergenic
1116241080 14:42343757-42343779 TTCCCAGTTGCTGATGCTGCTGG + Intergenic
1116397470 14:44463682-44463704 GTCCAAGGTGATGGTGCTCCTGG + Intergenic
1117610660 14:57479810-57479832 TTCCCAGGTGATGCTGATGCTGG + Intronic
1118671232 14:68129847-68129869 TTCCTAGATGATAGTGATGCTGG + Intronic
1118793939 14:69122509-69122531 GTGCCTATTGATGGTGAAGCAGG - Intronic
1119017327 14:71072538-71072560 GTCCCAGCTGATGGTGGTGGTGG - Intronic
1120004306 14:79339546-79339568 GTCTCAGGTGATGCTAATGCAGG - Intronic
1121632174 14:95429423-95429445 ATCCCAGGTGATGCTGCTGCTGG - Intronic
1123023648 14:105413549-105413571 GTCCAGGATGCTGGTGATGCTGG + Exonic
1124090298 15:26593086-26593108 TTCCCAGGTGATGCTGATGCTGG + Intronic
1125094931 15:35839729-35839751 CTCCCAGTAGATGGGGATACAGG + Intergenic
1125429878 15:39582962-39582984 GTACCAGGTGATGCTGATGCCGG + Intronic
1125774690 15:42201636-42201658 TTCCCAGATGATGCTGATGCTGG + Intronic
1128459280 15:67854039-67854061 GTGCCAGGTGCTGGTGATACAGG - Intergenic
1129567951 15:76643930-76643952 ATTCCAGATGATTGTGATGCAGG + Intronic
1129856861 15:78830943-78830965 ATCGCCGTTGATGGCGATGCAGG - Intronic
1129914784 15:79259250-79259272 TTCCCAGGTGATGCTGATGCAGG - Intergenic
1130038274 15:80381082-80381104 TTCCCAGGTGATGTTGCTGCTGG - Intronic
1132057490 15:98663236-98663258 GTCCCAGTTGATGGAGAGGCAGG + Intronic
1132231793 15:100189924-100189946 GGCCCCGGTGATGCTGATGCAGG - Intronic
1132715865 16:1289528-1289550 GTCCCAGGTGAGGGTGAGGGAGG - Intergenic
1133732872 16:8591108-8591130 GTCCGTGGTGATGGTGATGGTGG - Intergenic
1133732912 16:8591323-8591345 GTCCATGGTGATGGTGATGGTGG - Intergenic
1134485540 16:14655549-14655571 ATCCCAGCTGCTGGTGAGGCTGG - Intronic
1135256579 16:20946132-20946154 GTCTGTGTTGATGGTAATGCTGG - Intronic
1135326334 16:21528128-21528150 ATCACACTTGGTGGTGATGCGGG - Intergenic
1135588394 16:23688686-23688708 GACCCAGAAGATGGGGATGCAGG - Exonic
1136280319 16:29204832-29204854 GTACCCGTTGATGGGGTTGCAGG + Intergenic
1136353495 16:29727963-29727985 GTCCCAGCTGCTCGTGAGGCTGG - Intergenic
1137019106 16:35405988-35406010 ATCCCAGGTGTTGGTGAAGCAGG - Intergenic
1137272548 16:46911748-46911770 TTCCCAGGTGATACTGATGCCGG + Intronic
1137509003 16:49081811-49081833 CTCCCAGGTGATGATGATGCTGG + Intergenic
1139552559 16:67683196-67683218 CTCCCAGGTGATGCTGCTGCTGG + Intronic
1142084680 16:88170774-88170796 GTACCCGTTGATGGGGTTGCAGG + Intergenic
1142711874 17:1727923-1727945 GGCCCAGCTGATGGTGCGGCTGG + Exonic
1146267975 17:31465567-31465589 GTCCCAGCTAATGGGGAGGCAGG + Intronic
1147311243 17:39597222-39597244 CAGCCAGTTGATGGTGATGGGGG - Intergenic
1147519262 17:41153842-41153864 GTCCAAGATGATGGTGCTCCTGG - Intergenic
1148161104 17:45450633-45450655 GTCCCAGTTGTGGATGATCCTGG + Exonic
1150159867 17:62887476-62887498 GTCCCAGGTGATGCTGAAGCTGG + Intergenic
1150392338 17:64797279-64797301 GTCCCAGTTGTGGATGATCCTGG + Intergenic
1152169185 17:78732544-78732566 GTCACAGCAGATGGTGATACAGG + Intronic
1155218761 18:23665882-23665904 GTCCCAGTTGATGGTCCAACAGG + Intergenic
1155517759 18:26640316-26640338 GTCCCAGCTACTGGTGAGGCAGG + Intronic
1158518748 18:58152716-58152738 TTGCCAGGTGATGCTGATGCTGG + Intronic
1158570835 18:58595875-58595897 CTCCCAGGGGATGCTGATGCTGG + Intronic
1161611295 19:5244412-5244434 GTCCCACGTGATGGTGATGCTGG + Exonic
1162605610 19:11705185-11705207 GTCCCACATGATAGTCATGCAGG + Intergenic
1162960119 19:14120606-14120628 GTCCCAGTTGATATGGAAGCGGG + Exonic
1163064421 19:14782731-14782753 GTCTCAGTTCTTGGTGATGAGGG + Intergenic
1163619048 19:18347197-18347219 GTCCCAGCTAATGGGGAAGCTGG - Intronic
1165647966 19:37460258-37460280 ATCCCAGTTGAGGCTGAGGCAGG - Intronic
1166551195 19:43667496-43667518 GTCCCAGTTACTGGTGAGGAAGG + Intronic
1167844051 19:52145998-52146020 GTCACAATTGGTGGTGTTGCTGG + Intergenic
1168261299 19:55196571-55196593 GTCCCAGATGGTCGTGATGGTGG + Exonic
1168520416 19:57045986-57046008 CTCCCAGGGGATGGGGATGCAGG - Intergenic
925121808 2:1424360-1424382 GTCTGTGTTGATGTTGATGCTGG + Intronic
925739367 2:6992329-6992351 TTCTCAGGTGATGCTGATGCTGG + Intronic
930707276 2:54517103-54517125 GTCTGAGTTGATGTTAATGCTGG + Intronic
934579221 2:95425164-95425186 GTGCAATTTGATGGAGATGCAGG - Intergenic
934600225 2:95651560-95651582 GTGCAATTTGATGGAGATGCAGG + Intergenic
936533578 2:113293561-113293583 GTGCAATTTGATGGAGATGCAGG + Intergenic
936643297 2:114340844-114340866 TTCCCAGATGAGGCTGATGCTGG - Intergenic
937258293 2:120569802-120569824 GTAGCAGTTGAGGGGGATGCTGG - Intergenic
937701263 2:124865618-124865640 GTCCCAAGTGATGCTGATACTGG - Intronic
938733778 2:134167522-134167544 TTCCCAGGTGATGATGTTGCCGG + Intronic
938810261 2:134846258-134846280 TTCCCAGGTGATGGTGAAACTGG - Intronic
939131323 2:138238972-138238994 TTCCCAAGTGATGCTGATGCAGG - Intergenic
939951417 2:148478741-148478763 ATGCCAGTTCATGGTGCTGCTGG + Intronic
940034169 2:149295906-149295928 TTCCCAGGTGATGGTGATGCTGG + Intergenic
941705435 2:168653729-168653751 GTCACAGTTGTTAGTGTTGCTGG - Intronic
942427326 2:175873829-175873851 CTCCCAGGTGATGCTGATGTTGG - Intergenic
945024487 2:205606887-205606909 GGCCCAGGTGATTCTGATGCAGG - Intronic
946402639 2:219476707-219476729 GTCCCAGTTGGTGGGGGTGGGGG + Intronic
946572544 2:221040642-221040664 GCTCCAGTTGGTTGTGATGCTGG + Intergenic
1168813335 20:720477-720499 ATCCTGGTTGATGCTGATGCTGG + Intergenic
1169075325 20:2756505-2756527 GTCCTTGTTGATGGGGATGGTGG + Intronic
1169998184 20:11582989-11583011 TTCCCAGGTGATGCTGATGTTGG - Intergenic
1170609096 20:17897099-17897121 GCCCCTGTTGGTGGTGATGGTGG - Intergenic
1170649752 20:18228512-18228534 GTCCCAGTTGATGGCGGGGGTGG - Intergenic
1171544495 20:25989970-25989992 TTCCCAGTTGCTCGTGATGGTGG + Intergenic
1171943990 20:31359686-31359708 TTTCCAGGTGATGCTGATGCTGG - Intergenic
1171963035 20:31509005-31509027 ATCTCACTTGATGCTGATGCTGG - Intergenic
1172377990 20:34461595-34461617 GTCCCAGCTGAGGCTGAGGCAGG + Intronic
1173022962 20:39283335-39283357 ATCCCAGGTGATTCTGATGCAGG + Intergenic
1173253778 20:41378503-41378525 GTGCCAGGTGATAGTGATTCTGG - Intergenic
1174262472 20:49306691-49306713 CTCCCAGGGGATGCTGATGCTGG + Intergenic
1174365966 20:50056621-50056643 GCCCCTGTTGATGATGATGTAGG + Intergenic
1174647961 20:52102374-52102396 TTCCCAGTTGATGCCGATGCTGG + Intronic
1175531860 20:59678997-59679019 TTCCCAGGTGATGCTGACGCCGG + Intronic
1176624948 21:9084662-9084684 ATCTCAGTTGCTGGTGATGATGG + Intergenic
1177437472 21:21074819-21074841 GTCTCTGTTGATGGTGGTGATGG + Intronic
1178079853 21:29052176-29052198 CTCTCAGGTGATGCTGATGCTGG + Intronic
1178111226 21:29372063-29372085 TTCCCAAGTGATGTTGATGCGGG + Intronic
1178492434 21:33061289-33061311 CTCCCAGATGAAGCTGATGCCGG - Intergenic
1178905815 21:36635208-36635230 GTCCCAGCTGCTGGGGAGGCTGG - Intergenic
1179280901 21:39933519-39933541 GTCCAAGATGAAGGTGCTGCAGG + Intergenic
1179885730 21:44313536-44313558 GACCCAGTGGATGGAGAGGCAGG - Intronic
1180578213 22:16801428-16801450 GTCCCAGTTATTGCTGAGGCAGG + Intronic
1180951233 22:19721526-19721548 GAGATAGTTGATGGTGATGCTGG + Intronic
1181319728 22:21995117-21995139 GTCCCAGGTAAGGGGGATGCTGG - Intergenic
1181455071 22:23054540-23054562 GTCCCTGTTCATGATGATCCTGG - Intergenic
1182275319 22:29184803-29184825 GTCCCAGTTAATGAGGATTCTGG - Intergenic
1182276447 22:29192121-29192143 GTCCTAGTTGAGGATGAGGCAGG + Intergenic
1183655586 22:39182835-39182857 GTCCTGGTTGCTGGAGATGCAGG + Intergenic
1184716763 22:46287014-46287036 GGCCCAGATGATGGGGCTGCAGG - Intronic
949625126 3:5857151-5857173 GTCCCAGCTGAAGCTGAGGCAGG + Intergenic
950258440 3:11525146-11525168 GTCCCAGCTGAGGCTGAGGCAGG - Intronic
951503097 3:23412748-23412770 TTCCCAGGCAATGGTGATGCTGG - Intronic
951682483 3:25309250-25309272 GTCTCAGTTGAGGCTGAGGCAGG - Intronic
952156668 3:30650737-30650759 TTCCCAGGTGATACTGATGCTGG - Intronic
953023946 3:39134211-39134233 GTCCCAGGTGATGCTGGAGCTGG + Exonic
953370142 3:42380631-42380653 TTCCCAGGTGATGATGATGATGG + Intergenic
953582898 3:44173184-44173206 GTGCCAGTGAATGGTGAAGCTGG - Intergenic
953724538 3:45386634-45386656 TTCCCAGGTGAGGCTGATGCTGG + Intergenic
954340000 3:49945762-49945784 GTCCCAGCTGCTGGGGAGGCTGG + Intronic
954923495 3:54212568-54212590 GTCTCTGTTGATGTTAATGCTGG + Intronic
955141645 3:56275695-56275717 CTCCCAGAAGATGTTGATGCTGG + Intronic
956125588 3:66008237-66008259 CTCCCACGTGATGCTGATGCTGG - Intronic
956728720 3:72177555-72177577 GTCCCTGTTGATGGTCAGGCTGG + Intergenic
957197763 3:77092165-77092187 ATCCCAGATGATTCTGATGCAGG + Intronic
958501459 3:94914865-94914887 GTCCCAGCTGAGGCTGAGGCAGG + Intergenic
961144601 3:124583763-124583785 TTCCCAGGTGATGCTGATGTTGG - Intronic
961160742 3:124722593-124722615 ATCCCAGATGATGATGATCCTGG + Intronic
961486398 3:127220256-127220278 TTCCCAGGCGATGCTGATGCTGG + Intergenic
961870502 3:129984307-129984329 GTCCCAGGTGCTGGTCCTGCAGG - Intergenic
963890788 3:150634007-150634029 GTCCCAGCTGAGGCTGAGGCAGG + Intergenic
964782085 3:160350695-160350717 GTCCCAGTTACTTGTGAGGCTGG + Intronic
965294910 3:166932218-166932240 GTCCCAGCTGAGGCTGAGGCAGG + Intergenic
968514036 4:1008991-1009013 TTCCCAGTTGAGGGAGACGCCGG + Intergenic
968953304 4:3705831-3705853 GTCACATTAGATGGGGATGCAGG - Intergenic
970569280 4:17363837-17363859 GTCCCAGCTGAGGCTGAGGCAGG + Intergenic
972143677 4:35994547-35994569 GTCCCAGCTGAGGCTGAGGCAGG - Intronic
972177301 4:36423510-36423532 ATCCCAGATGATTTTGATGCAGG + Intergenic
973238878 4:47935546-47935568 CTCCCAGGTGATGCTCATGCTGG + Intronic
973979035 4:56291263-56291285 TTCGCAGTTGATTGTGAAGCAGG - Intronic
975806659 4:78119786-78119808 GTCCCAGGTGATTCTGATACTGG + Intronic
976225072 4:82789509-82789531 CTCCCAGGTGATGCTGATGCTGG + Intronic
976671265 4:87656795-87656817 GTCCTAGTTGATGCTGATGCTGG - Intronic
979636341 4:122958681-122958703 TTCCCAGGTGATGCTAATGCTGG + Intronic
981045443 4:140260774-140260796 ATCCCAGGTGATTCTGATGCAGG + Intronic
982572448 4:157067326-157067348 GTTCAAATTGTTGGTGATGCTGG + Intergenic
982694616 4:158585054-158585076 TTCCCAGGTGATGCTGCTGCTGG + Intronic
982865274 4:160502278-160502300 GTCCCAGGTGATGGTAGTCCTGG + Intergenic
985109493 4:186534364-186534386 GTAGCGGTTGATGGCGATGCCGG + Exonic
987217635 5:15754118-15754140 GTCCCAGGTGATAATGATGCTGG + Intronic
987288774 5:16488076-16488098 GTCCTAGATGATGCTGAGGCAGG + Intronic
987719749 5:21618074-21618096 GTCTGTGTTGATGCTGATGCTGG - Intergenic
988312112 5:29573230-29573252 TTTCCAGTTGATGGTGCAGCTGG - Intergenic
988553869 5:32220131-32220153 GTCCCAGCTGAGGCTGAGGCAGG - Intergenic
988623856 5:32850240-32850262 GTCCCAGATCAAGGTGCTGCTGG - Intergenic
989112237 5:37917445-37917467 CACCCTATTGATGGTGATGCAGG - Intergenic
989446001 5:41529147-41529169 GTCTCTGTTGATGCTAATGCTGG - Intergenic
990241223 5:53818469-53818491 GCCACAGGTGATGGTGATGATGG - Intergenic
991360346 5:65813381-65813403 GTCCTGGTTGAAGGTCATGCAGG - Intronic
991651768 5:68862911-68862933 TTCCCAGGTGATGGTGTTCCAGG - Intergenic
992422243 5:76618131-76618153 GTAGCGGTTGATGCTGATGCAGG + Exonic
992540493 5:77759386-77759408 GTCTCTGTTGATGTTAATGCTGG + Intronic
996556925 5:124787860-124787882 GTCCCAGCTACTGGGGATGCTGG - Intergenic
997796218 5:136814007-136814029 TTCCCAGCTGATGCTGATCCAGG - Intergenic
998790617 5:145762948-145762970 TTTCCAGGTGATGGTGATCCTGG - Intronic
999107680 5:149087988-149088010 GTCCCTGCTGAGGGTGATGATGG + Intergenic
999403278 5:151284052-151284074 GGGCAAGTTGAGGGTGATGCTGG + Exonic
999540107 5:152561867-152561889 TTTCCAGATGATTGTGATGCTGG + Intergenic
999913653 5:156233765-156233787 GTCCCAGTTCATTGGGAAGCTGG + Intronic
1000072470 5:157753600-157753622 GCCCCAGGTGATTCTGATGCAGG - Intronic
1000957332 5:167558790-167558812 GACCCAGTGGATGGTGGTGGTGG - Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001769689 5:174284164-174284186 GAATCAGTTGATGGTGATGAGGG + Intergenic
1002508166 5:179695165-179695187 GTCCCAGCTGCTGGGGAGGCTGG - Intronic
1002992563 6:2251247-2251269 GTCCCAGCTACTGGGGATGCTGG + Intergenic
1002994350 6:2268842-2268864 GTCCCAGGTGATGCTGCTGCTGG + Intergenic
1004641962 6:17524375-17524397 GTGTCAGTTGATAATGATGCAGG + Intronic
1004651342 6:17612744-17612766 GTCCCAGTTTCTGGTGATGGGGG + Intergenic
1004763669 6:18699840-18699862 CTGCCAGGTGATGCTGATGCTGG - Intergenic
1005717510 6:28565328-28565350 GTCCCAGCTGAGGCTGAGGCAGG - Intergenic
1006558046 6:34886185-34886207 GTCCCAGTTACTGGGGAGGCTGG + Intronic
1007112534 6:39321202-39321224 CTCCCAGGTGATGCTGATTCTGG + Intronic
1007817766 6:44536747-44536769 GTCAGAGTTGATGGTGATGATGG + Intergenic
1007895278 6:45349465-45349487 TTCCCAGGTGATGTTGATGTTGG - Intronic
1010739299 6:79481093-79481115 GTCCCAGTTGATATTGATCCTGG - Intergenic
1012903891 6:105041723-105041745 ATCCCATGTGATGCTGATGCTGG - Intronic
1015016510 6:128419495-128419517 GTCCCAGCTGAGGCTGAGGCAGG + Intronic
1015878917 6:137851456-137851478 GTCCCAGCTGCTGCTGCTGCTGG - Intergenic
1016264892 6:142221168-142221190 TTCGCAGGTGATGCTGATGCCGG - Exonic
1017051996 6:150402037-150402059 TTCCCAGGTGTTGCTGATGCTGG + Exonic
1018045773 6:159965185-159965207 GTCCCAGCTTCTGGTGTTGCTGG + Intergenic
1018803143 6:167238729-167238751 GTCTGTGTTGATGTTGATGCTGG - Intergenic
1021418842 7:20422009-20422031 GCCCCAGTTGAAAGTGATGTAGG - Intergenic
1023225511 7:37964921-37964943 CTTCCAGGTGATGCTGATGCTGG + Intronic
1023951787 7:44852023-44852045 GTTCCAAGTGATGCTGATGCTGG - Intergenic
1024052663 7:45638642-45638664 GTCCCTGTTGTTGGACATGCAGG + Intronic
1024622070 7:51169045-51169067 GTCTGAGTTGATGTTAATGCTGG - Intronic
1026301500 7:69101971-69101993 CTCCCAGATGATCCTGATGCTGG + Intergenic
1027736042 7:81934105-81934127 GTCCCAGCTGATCGGGAGGCTGG + Intergenic
1028400702 7:90422368-90422390 ATCCCAGTTGATGTTAGTGCTGG + Intronic
1028543548 7:91972381-91972403 GCCCAAGTTGATGGAGAAGCTGG + Intronic
1030332751 7:108289777-108289799 TTTCCAGTTTATGCTGATGCTGG - Intronic
1030796578 7:113795904-113795926 CTCCCATGTGATGATGATGCTGG - Intergenic
1031227143 7:119053929-119053951 GTCTCTGTTGATGTTAATGCTGG + Intergenic
1034202954 7:149294004-149294026 GGCCCAGATGAAGGTGCTGCTGG + Intronic
1034280642 7:149851616-149851638 GTACCAGGCGATGGTGTTGCTGG + Intronic
1035036356 7:155897790-155897812 GTCCCAGTCCATGGTGGGGCAGG - Intergenic
1039503274 8:38033180-38033202 GTCCCAGTTATTGGGGAGGCTGG - Intronic
1040290787 8:46123075-46123097 GACTCAGTTGATGATGAGGCAGG - Intergenic
1040711085 8:50189444-50189466 TTCCCAGGTGCTGCTGATGCAGG + Intronic
1041830063 8:62143861-62143883 GACCCAGAAGATGGAGATGCAGG + Intergenic
1041893732 8:62900857-62900879 CTCACAGTTGATGGTTATGGTGG - Intronic
1043389724 8:79780861-79780883 TTCCCAGATGATGCTGATGCTGG + Intergenic
1043740751 8:83808457-83808479 GTCCATGTTGATGTTAATGCAGG - Intergenic
1045697598 8:104827737-104827759 TTCCCAGATGATCCTGATGCTGG - Intronic
1046890519 8:119416592-119416614 GTCCCAGGAGATGGAGAAGCAGG - Exonic
1047812931 8:128429879-128429901 GTCTCAGTTGCTGCTGCTGCAGG - Intergenic
1048406362 8:134126634-134126656 TTCCCAGTTACTGCTGATGCAGG + Intergenic
1049397097 8:142405965-142405987 GGCCCAGCTGCTGGTGAGGCTGG - Intergenic
1050110533 9:2211001-2211023 CTCACAGGTGATGCTGATGCTGG + Intergenic
1050153691 9:2643322-2643344 TACCCAGCTGATGGGGATGCAGG - Exonic
1051640601 9:19221248-19221270 GTCCTAGTTGCTAGTGAGGCTGG + Intergenic
1052055637 9:23904192-23904214 ATCCCAGGTGATGCTGATGCAGG - Intergenic
1055407642 9:75991326-75991348 TTTCCAATTGATGCTGATGCTGG + Intronic
1056020208 9:82432254-82432276 TGCCCAGCTGATGGTGATGGTGG - Intergenic
1056052253 9:82781384-82781406 TTCCCAGGTGATGCTGCTGCTGG - Intergenic
1056289796 9:85131583-85131605 TTCCCAGTTGCTGGTGATTAGGG - Intergenic
1056444097 9:86647985-86648007 GATCCAGGTGATGCTGATGCAGG + Intergenic
1056775270 9:89507768-89507790 GTCTGTGTTGATGTTGATGCTGG + Intergenic
1057167515 9:92940602-92940624 GGCCCAGTGGAGGGTGATGGTGG - Intergenic
1057410031 9:94809949-94809971 TTCCCAGCTGATTGTGCTGCAGG + Intronic
1060471850 9:123954688-123954710 CTCCCAGAAGATGCTGATGCTGG + Intergenic
1061012800 9:127965395-127965417 CTCCCAGGTGATTCTGATGCAGG + Intronic
1061133576 9:128721346-128721368 TTCCCAGGTGGTGGTGTTGCTGG + Exonic
1061590476 9:131594537-131594559 CTCCCAGCTGCTCGTGATGCTGG + Intronic
1061982277 9:134112850-134112872 GTCCCAGTTACTGGGGAGGCTGG + Intergenic
1062264447 9:135680313-135680335 GTCCCAGGTGATGCTGTAGCAGG + Intergenic
1062561065 9:137142122-137142144 GTCCGAGTAGATGGACATGCGGG - Exonic
1185752135 X:2620714-2620736 GTCCCAGTTTATTTTGATGATGG + Intergenic
1186864752 X:13708481-13708503 GTCACAGTTGACTGTGAAGCTGG - Intronic
1187283803 X:17883498-17883520 TTCCCAGGTGATGCTCATGCTGG + Intergenic
1187783667 X:22859631-22859653 GTTCCAGTTTATGGTCATGTAGG - Intergenic
1187797608 X:23021457-23021479 TTCCCAGATGATGCTGATGTTGG + Intergenic
1188380506 X:29485970-29485992 GTCCCAAGTGTTGCTGATGCTGG - Intronic
1188659916 X:32746454-32746476 GTCCCAGGTGACGCTGATGCTGG - Intronic
1188904134 X:35772269-35772291 GTCTCTGTTGATGGTAATACTGG + Intergenic
1190408790 X:50114274-50114296 GTCCCTGTTGATGTTAACGCTGG + Intergenic
1190458899 X:50651480-50651502 TTCTCAGGTGATGCTGATGCTGG - Intronic
1190838613 X:54125095-54125117 ATCCCAGTTGAGGCTGAGGCAGG + Intronic
1193992648 X:88327552-88327574 GTCCCAAGTGATGATGATGCAGG + Intergenic
1194408499 X:93528085-93528107 CCCCCAGATGATGATGATGCTGG + Intergenic
1194644233 X:96439110-96439132 ATCTCAGGTGATGCTGATGCCGG + Intergenic
1195753618 X:108179989-108180011 TTCCTAGGTGATGCTGATGCTGG + Intronic
1196087254 X:111697403-111697425 TTCCCAGGTGATGATGATGCTGG - Intronic
1196395736 X:115260159-115260181 GTCCCAGCTGAGGCTGAGGCTGG - Intergenic
1197324831 X:125080101-125080123 CTTCCAGGTGATGCTGATGCTGG - Intergenic
1198445213 X:136706690-136706712 GTACCAGCTGATGGGGATACAGG - Intronic
1201250174 Y:12049529-12049551 TTCCCAGGTGATGCTGATGAGGG - Intergenic
1202348079 Y:23956298-23956320 GTCACAGTTGACTGTGAAGCTGG - Intergenic
1202522695 Y:25713806-25713828 GTCACAGTTGACTGTGAAGCTGG + Intergenic