ID: 1080569555

View in Genome Browser
Species Human (GRCh38)
Location 11:33543442-33543464
Sequence GCTTGTATGGAGAGTATGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080569555_1080569564 27 Left 1080569555 11:33543442-33543464 CCTTCCATACTCTCCATACAAGC 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1080569564 11:33543492-33543514 CTTTTCCAGCACCAAGCCAGAGG 0: 1
1: 0
2: 4
3: 10
4: 181
1080569555_1080569561 4 Left 1080569555 11:33543442-33543464 CCTTCCATACTCTCCATACAAGC 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1080569561 11:33543469-33543491 CAGACTGTTTTCCCATCTCTTGG 0: 1
1: 0
2: 3
3: 17
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080569555 Original CRISPR GCTTGTATGGAGAGTATGGA AGG (reversed) Exonic
904302530 1:29563794-29563816 GCCTGTGTGGAGATTATGAAGGG + Intergenic
905518193 1:38577734-38577756 GCTTGGAGGGTGAGTAAGGATGG + Intergenic
908459888 1:64339015-64339037 GCCAGTATGGAGAGAATGGCAGG + Intergenic
909168343 1:72258057-72258079 GCATGAATGGAGATTAGGGAAGG - Intronic
910971311 1:92858778-92858800 GCTTGTATAGAAAGGATGGTTGG + Intronic
911579603 1:99619672-99619694 GCTTGAAATGAGAGTATGGGAGG - Intergenic
911707191 1:101027015-101027037 ACTTGTATGGAGAATATATAAGG + Intergenic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
912991567 1:114492577-114492599 GCTTGCAGGGAGAATAGGGAGGG - Intronic
913433449 1:118821666-118821688 GATTGTCTGGATATTATGGAGGG - Intergenic
914003295 1:143710760-143710782 GCTTATCAGGAGAGAATGGAAGG - Intergenic
915313248 1:155015066-155015088 GCTTGCATGGAGATTCTGCAGGG + Exonic
920366191 1:205449619-205449641 GCATGTCTGGAGTGTGTGGAGGG - Intronic
921709528 1:218359767-218359789 GTTTGTGTGGAGAGGCTGGAGGG + Intronic
1065377782 10:25060510-25060532 GCTTATGTGGAGAGTATGTGGGG - Intronic
1065481202 10:26195598-26195620 GCTGGAGTGGAGAGTTTGGAGGG - Intronic
1068391947 10:56409153-56409175 GCTTGGATGTGGGGTATGGAGGG - Intergenic
1071126670 10:82343965-82343987 TCTTGTCTGGAAAGTATGTATGG - Intronic
1074185441 10:111096662-111096684 TCTTGTATGGGAAGCATGGAGGG + Intergenic
1075359632 10:121819352-121819374 GCATGTATTGTGAGTATGCATGG - Intronic
1075925877 10:126251672-126251694 GATGGGATGGAGAGGATGGATGG + Intronic
1078670136 11:13357260-13357282 GCCAGTATGGAGAGCATGGAGGG - Intronic
1079169785 11:18081823-18081845 GTTTGAATGGAGAGGAGGGATGG - Intronic
1079249314 11:18775565-18775587 GCTTGCATGGGGAGTTTGGGAGG + Intronic
1080452658 11:32391281-32391303 GCTTGTAAGTAGAGTAAGGTAGG - Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1083083504 11:60118071-60118093 GCTTGGATGGGTAGTAGGGAGGG + Intergenic
1084722593 11:70916926-70916948 GCATGTGGGGAGGGTATGGAGGG + Intronic
1086071182 11:82801388-82801410 TCTTGTATGCAGAATATGGTTGG + Intergenic
1086945623 11:92841258-92841280 GCAGGTATGCAGAGTATAGAAGG + Intronic
1088013700 11:105034634-105034656 ACATGTATGGAGACTATTGAGGG - Intronic
1088019374 11:105100939-105100961 ACATGTATGGAGACTATTGAGGG - Intronic
1088052170 11:105530245-105530267 TCTGGTTTGGAGAGTCTGGAGGG + Intergenic
1091649686 12:2300833-2300855 GCCTGTTGGGAGAGTAGGGAGGG + Intronic
1094218816 12:27971875-27971897 ACTTGTTTGGATAGTATGAAAGG + Intronic
1095704342 12:45221241-45221263 GATTGTATTGAGAGTACAGAAGG + Intronic
1096007096 12:48182594-48182616 CGTTGTGTGGAGGGTATGGATGG - Intergenic
1099145441 12:79037713-79037735 GCTGGTAGGAACAGTATGGAAGG - Intronic
1099916397 12:88899789-88899811 GACAGAATGGAGAGTATGGAGGG + Intergenic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1108809402 13:54202705-54202727 GATTGTGTTGAGAGTATGGACGG + Intergenic
1113081861 13:106528745-106528767 GCTGAAATGGAAAGTATGGAAGG + Intronic
1114399888 14:22400257-22400279 GCTTGCATGGGGAGATTGGAGGG - Intergenic
1115041110 14:28929460-28929482 GCTTGCAGAGAGAATATGGAAGG + Intergenic
1117857842 14:60054110-60054132 GCCTGTTAGGAGAGTATGTATGG - Intronic
1119723691 14:76908890-76908912 GCTTGTGTGGAGAGCATGTGAGG + Intergenic
1121110177 14:91307317-91307339 GCGAGTATGGGGAGTGTGGAGGG - Intronic
1122115508 14:99525446-99525468 GCTTGTTTGGAAAGGATGGGTGG + Intronic
1124173205 15:27396266-27396288 GCTTGTATCCAGAGTATGTAAGG + Intronic
1125529101 15:40399962-40399984 ACTTCTAAAGAGAGTATGGAAGG - Intergenic
1128681294 15:69653808-69653830 GCTTGTAAGGAGAGCAGGGAAGG + Intergenic
1133206539 16:4237490-4237512 GTTTGTAGGAAGAGTAGGGAGGG - Intronic
1133613577 16:7455390-7455412 TCTTGCATGGAGAGTAAGGCTGG - Intronic
1135618196 16:23930215-23930237 CTTTGTATGGATTGTATGGATGG + Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136476598 16:30517491-30517513 GGGTGTATGGAGAGTAAGGATGG + Intronic
1136667236 16:31822557-31822579 GCTTGTATTAAGTGTATCGATGG - Intergenic
1137298233 16:47118542-47118564 TGATGTTTGGAGAGTATGGAGGG - Intronic
1140184117 16:72751453-72751475 GCTTGTGACGAGAGTATGTATGG - Intergenic
1141603380 16:85139452-85139474 GCTGGGCTGTAGAGTATGGAAGG + Intergenic
1146904591 17:36609765-36609787 GATTGTTGGGAGAATATGGAGGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149478276 17:56981885-56981907 GATTGTATGGAGAGGAAGGGAGG - Intronic
1150553235 17:66230427-66230449 GTTGGTATGGGGAGGATGGAAGG - Intronic
1150573150 17:66405749-66405771 GCCTGAATGGAGAAGATGGAAGG + Intronic
1150993937 17:70294317-70294339 GCCTGTCTGGAGAGGATGGAGGG + Intergenic
1151098923 17:71533041-71533063 GCTTTTATAGAGAGTCTGGGAGG + Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1152722405 17:81929388-81929410 GCTTGTAGAAAGAGTATCGAGGG + Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1159165939 18:64700282-64700304 TCTTGTGTGGTGAGTATTGAGGG - Intergenic
1159840285 18:73391276-73391298 GCTGATTTGGAGAATATGGATGG - Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
925101702 2:1252420-1252442 GGTTGTAGGGAGATTAAGGAAGG + Intronic
925666425 2:6261769-6261791 GCTAGCATGGAGTATATGGAAGG - Intergenic
925700268 2:6629659-6629681 GCTAGGATGGAGAGTATGCACGG - Intergenic
925756827 2:7141309-7141331 GCTTGTTTGGAGATTCTAGAAGG + Intergenic
925843827 2:8017983-8018005 GCCTGGATGGAGTGAATGGAAGG + Intergenic
929483577 2:42335889-42335911 GGTTGTAGGGATAGTAGGGAAGG - Intronic
931209814 2:60181967-60181989 GCTTGTATGTAGACTTGGGATGG - Intergenic
932082701 2:68730290-68730312 ACTTGTATGGTGATTATGCACGG + Intronic
935181240 2:100692933-100692955 GCTTGCAGGGAGAGTGGGGAGGG - Intergenic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
939921944 2:148126555-148126577 GTGTGTATGGAGAATATGGAAGG - Intronic
940277373 2:151953369-151953391 GCTTGAAAGGAGAGCATGGCAGG - Intronic
942552632 2:177135382-177135404 TCTTGTGTGTAGAATATGGAGGG - Intergenic
945758067 2:213875051-213875073 GGTCGTATGGAGAGTAAGGCAGG - Intronic
1168892906 20:1306238-1306260 GCTTCGATGGAGAGCAGGGAAGG + Exonic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1178095644 21:29212306-29212328 GGTTAAATGGAGACTATGGAAGG - Intronic
1178301729 21:31458873-31458895 GCTTGGAAGGAGAGTATTGGGGG + Intronic
1179228300 21:39476177-39476199 GCTAAGATGGAGAGTAGGGAAGG + Intronic
1180917765 22:19500700-19500722 GCTTTTAGGGAGACTGTGGAGGG - Intronic
1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG + Intergenic
1181897726 22:26125645-26125667 GCTTGTTTGAAGAGTAGGCATGG - Intergenic
1183211838 22:36455841-36455863 GCTTGGAGGGAGAATATGGTGGG - Intergenic
1183481351 22:38067205-38067227 GCTTGGATGTAGAGTAGGAAGGG + Intronic
1185265675 22:49901656-49901678 GCATGTATGGTGTGTATGCATGG + Exonic
949779722 3:7672480-7672502 GCTTTAATGGAGTCTATGGATGG - Intronic
950804059 3:15581661-15581683 GCTTGTGTAGATAGTATGGAAGG - Intronic
953991876 3:47490118-47490140 ACTTGTATCCAGAATATGGAAGG - Intergenic
955965151 3:64381597-64381619 GCTTGCATTGAGAGAAGGGAAGG - Intronic
957761912 3:84569691-84569713 GCTAGTTTGGAGTATATGGAGGG - Intergenic
961056436 3:123792931-123792953 GGTTGTCTGGAGAGTTTGCAGGG - Intronic
963801831 3:149683844-149683866 GCTGGGGTGGAGATTATGGATGG + Intronic
965235125 3:166108756-166108778 GATTTTAGGGAGTGTATGGAAGG + Intergenic
966639056 3:182168908-182168930 GATTGAATGTAGAGTATGAAGGG - Intergenic
968706620 4:2081281-2081303 GCATGCATGGGGAGGATGGAAGG + Intronic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
975827700 4:78337170-78337192 GCTTGAAGGGAGTGTCTGGATGG + Intronic
977734189 4:100392274-100392296 GCTTGTATCTAGAATATGTAAGG - Intergenic
979505897 4:121496528-121496550 TCTTGTATGCAGTGTAAGGAAGG + Intergenic
980435404 4:132765473-132765495 ACTTGTATTGAGAATATGAAAGG + Intergenic
981226402 4:142299593-142299615 GCATGGATGGAAAGCATGGATGG - Intronic
982800530 4:159700612-159700634 TCTTGTAGGTAGAGTATGGTTGG + Intergenic
990467352 5:56082798-56082820 GCGTATATGGAAAGTATGGAAGG + Intergenic
990694841 5:58404450-58404472 GCTTTTCTTGAGAGTATGGTGGG - Intergenic
991189840 5:63857319-63857341 ACTTGTATGAAAAGTGTGGAGGG - Intergenic
995008001 5:107224973-107224995 GCTTGTATGGAAAGCATGTGTGG - Intergenic
1003967610 6:11268139-11268161 GCTACTAGGGAGAGTAAGGAGGG - Intronic
1006531791 6:34661789-34661811 GCTTCTAGGGAGAGTTTGAATGG + Intronic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1009311101 6:62153821-62153843 GCCTGGATGGAGAGTTTTGAGGG - Intronic
1012177237 6:96103106-96103128 GCTTGAATGGGGAGTAGGGGAGG + Intronic
1012547177 6:100433139-100433161 ACTGGTTTGGAGAGTATGGATGG - Intronic
1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG + Intergenic
1016483781 6:144512317-144512339 GCTTGAATGGAGAGTTTGAAAGG - Intronic
1019103537 6:169650596-169650618 GCATGGATGGAGGGGATGGAGGG - Intronic
1022502666 7:30892458-30892480 GCTGGTATGGAGAATGTGGTAGG + Intergenic
1023095347 7:36654607-36654629 GCAGGGATGGAGAGGATGGATGG - Intronic
1028650445 7:93144896-93144918 GCTTGTATAGAGACTATGGGAGG - Intronic
1028682420 7:93551685-93551707 TCCTGGATGGAGAGGATGGAAGG + Intronic
1030237406 7:107279969-107279991 CCTTGCATTGAGAGTAGGGAGGG - Intronic
1032698995 7:134362354-134362376 GCCAGTATGGGGAGCATGGATGG - Intergenic
1033635021 7:143204324-143204346 GCTTGTATGGAGAGAGAGAAAGG - Intergenic
1035765665 8:2103160-2103182 GCATGTATTGTGTGTATGGATGG + Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1041451836 8:58013886-58013908 GCTTGTACGCAGAGTACAGAAGG + Intronic
1041840085 8:62259020-62259042 GCTTGCATGAAGGGTATGGTGGG + Intronic
1041861671 8:62520946-62520968 GCTTGTATGGAAAGAGTGCATGG + Intronic
1043189331 8:77198036-77198058 AGTTGTATGGAGAGTATGTGAGG + Intergenic
1045810613 8:106216048-106216070 ACTTGTGTGCAGAGTATGGCTGG + Intergenic
1047654002 8:126955619-126955641 CCTGCTATGGTGAGTATGGAGGG + Intergenic
1047890604 8:129303950-129303972 GCCTGTGTGCAGAGTATAGAGGG + Intergenic
1048592516 8:135833917-135833939 GAATGAATGGAGAGGATGGATGG - Intergenic
1050046856 9:1555421-1555443 GATTGTATGAAAAGTATTGATGG + Intergenic
1051817912 9:21131482-21131504 GCTAGGATGGAGAGTATGGAGGG + Intergenic
1059703663 9:116800038-116800060 GCTTGTTTTGAGAGACTGGATGG - Intronic
1060051322 9:120380427-120380449 GCTTGTATGTAATGTATTGAAGG - Intergenic
1060277244 9:122191599-122191621 GCTGGTATGGGGAGTAGGGAAGG - Intronic
1060969303 9:127729195-127729217 ACTTGTATTGGGAGAATGGATGG + Intronic
1186818634 X:13263537-13263559 GGTTGATTGGACAGTATGGATGG + Intergenic
1187118398 X:16378508-16378530 GAATGTATGGAATGTATGGAAGG - Intergenic
1190699663 X:52978084-52978106 GCTTGTATGGAAAATTTGAATGG - Intronic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1195294496 X:103462388-103462410 GATTGTATTGTGAGTGTGGAGGG + Intergenic
1201570906 Y:15413357-15413379 ACTTGTATGCAGAATATGTAAGG + Intergenic