ID: 1080570571

View in Genome Browser
Species Human (GRCh38)
Location 11:33552974-33552996
Sequence CATTTCCCAGGGATTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080570571_1080570578 28 Left 1080570571 11:33552974-33552996 CCAGGGAAAATCCCTGGGAAATG 0: 1
1: 0
2: 2
3: 23
4: 232
Right 1080570578 11:33553025-33553047 GAGATGAGGTTAGAAGCTACAGG 0: 1
1: 1
2: 2
3: 16
4: 154
1080570571_1080570577 14 Left 1080570571 11:33552974-33552996 CCAGGGAAAATCCCTGGGAAATG 0: 1
1: 0
2: 2
3: 23
4: 232
Right 1080570577 11:33553011-33553033 TGAGGAGGAAGTAAGAGATGAGG 0: 1
1: 1
2: 13
3: 95
4: 920
1080570571_1080570575 -4 Left 1080570571 11:33552974-33552996 CCAGGGAAAATCCCTGGGAAATG 0: 1
1: 0
2: 2
3: 23
4: 232
Right 1080570575 11:33552993-33553015 AATGAATCATGGCATGAGTGAGG 0: 2
1: 0
2: 0
3: 22
4: 232
1080570571_1080570576 -1 Left 1080570571 11:33552974-33552996 CCAGGGAAAATCCCTGGGAAATG 0: 1
1: 0
2: 2
3: 23
4: 232
Right 1080570576 11:33552996-33553018 GAATCATGGCATGAGTGAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080570571 Original CRISPR CATTTCCCAGGGATTTTCCC TGG (reversed) Intronic
900613082 1:3552716-3552738 CATTTCCAAGGGAGCCTCCCAGG - Intronic
903710854 1:25323046-25323068 CAGTTCCCAGGAATTTGCCCGGG - Intronic
903716092 1:25368383-25368405 CAGTTCCCAGGAATTTGCCCGGG + Intronic
904003920 1:27353517-27353539 CATCTCCCAGGGCCTGTCCCAGG - Intronic
904788051 1:32997331-32997353 TGTTTCCCAGGGACTTTCCTGGG - Intergenic
906186511 1:43866152-43866174 AACTTCCAAGGCATTTTCCCAGG - Intronic
906720213 1:47998553-47998575 CATCTCCCAGGCGTCTTCCCTGG - Intergenic
907604140 1:55799563-55799585 CATTTCCTAGGTTTTCTCCCAGG + Intergenic
909448567 1:75774044-75774066 CATGTCCCAAGGAGTTGCCCAGG - Intronic
910011208 1:82464947-82464969 TATTTCCCAGGGATTTCCCTGGG - Intergenic
911952148 1:104187484-104187506 GATTTTCAATGGATTTTCCCAGG - Intergenic
914464517 1:147914347-147914369 CTTTTGCCAGAGATTTCCCCAGG - Intergenic
916174987 1:162030678-162030700 CCTTTCCAAGGAATTTTCCAGGG + Intergenic
917828674 1:178852755-178852777 CATTTCCCTGGTAAGTTCCCAGG + Exonic
917946381 1:179975907-179975929 CATTTCCAAGGCTTTTTCCTGGG - Intronic
918067778 1:181113144-181113166 CATTTCCCAAGGATCTTCCCAGG - Intergenic
921188436 1:212689376-212689398 CATTCCCCAGGCAGGTTCCCAGG + Intronic
923299506 1:232629246-232629268 GTGTTCCCAGGGATATTCCCAGG + Intergenic
924429412 1:243984246-243984268 CCTACCCCAGGGATTTGCCCAGG - Intergenic
1064304321 10:14151745-14151767 CATTTCCAAGAAATGTTCCCTGG - Intronic
1065092406 10:22248298-22248320 CATTCCCCAGTGTTTTTCCTGGG - Intergenic
1066458486 10:35593076-35593098 CATTTCCCAAGGAAATTGCCTGG + Intergenic
1066801985 10:39202865-39202887 CAGTTCCCAGGAATTTGCTCAGG - Intergenic
1066805629 10:39249245-39249267 CTTAGCCCAGGGATATTCCCTGG - Intergenic
1069072851 10:64007406-64007428 CTTTTCCCAGGGCTGTTCCTTGG + Intergenic
1069340088 10:67399571-67399593 CATCTCCCAAGGTTTTTTCCAGG + Intronic
1069921485 10:71818260-71818282 CATTGCCCAGAGCTTTGCCCAGG - Intronic
1072317939 10:94221938-94221960 CACTTCCCAGTGCTGTTCCCAGG - Intronic
1074183948 10:111085459-111085481 CATGTCCCAGGGTACTTCCCTGG - Intergenic
1074827375 10:117224180-117224202 CCTTGCCCAGGTCTTTTCCCAGG - Intergenic
1075231449 10:120683043-120683065 TGGTTCCCAGGGATTTTCCAAGG - Intergenic
1075391219 10:122093779-122093801 CATATACCAGGCATTATCCCAGG - Intronic
1075705841 10:124499918-124499940 CATTTCCCAGGTGTTTTCTGGGG - Intronic
1075808931 10:125210261-125210283 CACTTCCCAGGGCACTTCCCAGG - Intergenic
1076110293 10:127854966-127854988 CCTTTCCCTGGGATCATCCCTGG - Intergenic
1076547191 10:131253279-131253301 CCTTTTCCGAGGATTTTCCCAGG - Intronic
1078312933 11:10264500-10264522 CATGTGCCAGGTATTTTGCCAGG + Intronic
1079924192 11:26472329-26472351 CATTTACCAGGGATCTTAACAGG + Intronic
1080570571 11:33552974-33552996 CATTTCCCAGGGATTTTCCCTGG - Intronic
1081054861 11:38397159-38397181 CTTTTTTCAGGGATTTTCCCAGG + Intergenic
1081580414 11:44347929-44347951 CACCTCCCAGGGTTGTTCCCGGG + Intergenic
1081708738 11:45203173-45203195 CATCTCCCAGGAGTTCTCCCAGG + Intronic
1082167239 11:48963555-48963577 CACTCCCCAGGGATTTGCGCAGG - Intergenic
1082236338 11:49823144-49823166 CACTCCCCAGGGATTTGCACAGG + Intergenic
1082239789 11:49857652-49857674 CACTCCCCAGGGATTTGCACAGG + Intergenic
1082242363 11:49886699-49886721 CACTCCCCAGGGATTTGCGCAGG - Intergenic
1082753225 11:57045105-57045127 CTTTTCCCAGGTATATACCCTGG + Intergenic
1084547410 11:69821317-69821339 CAGTTCCCAGGGAAACTCCCGGG + Intergenic
1090559388 11:127914331-127914353 CATTTTGCAATGATTTTCCCAGG + Intergenic
1091579578 12:1775460-1775482 AATTTCAGAGTGATTTTCCCTGG - Intronic
1095905109 12:47369424-47369446 CACTTCCCGGGGTTATTCCCTGG - Intergenic
1098473575 12:70873340-70873362 CATTTCCCAGGCATTTTGACTGG - Intronic
1099001573 12:77183755-77183777 CATTGCCCAAGTATTTTTCCAGG - Intergenic
1101290536 12:103363000-103363022 CTTTTCACAGTGAATTTCCCAGG - Intronic
1101804087 12:108048256-108048278 CATTTCCCAGTAACTCTCCCTGG - Intergenic
1103276539 12:119716745-119716767 CATTTCCCAGGAATTTCTCCAGG + Intronic
1104154760 12:126120714-126120736 CATCTCCCAGGCATCTTCTCAGG + Intergenic
1104387399 12:128363377-128363399 CATGTTCCAGTGATTATCCCTGG - Intronic
1104437183 12:128765684-128765706 CATTTCCCCCGCAGTTTCCCCGG - Intergenic
1104794373 12:131506981-131507003 GCTTTCCCAGGGCTTGTCCCAGG - Intergenic
1105061702 12:133158408-133158430 TATTTGTCAGTGATTTTCCCAGG - Exonic
1106852707 13:33812360-33812382 GTTTTCCCAGGGATTTTGCGTGG - Intergenic
1107153638 13:37141275-37141297 CATTTCCCAGATATTCTCCAAGG + Intergenic
1108167468 13:47708526-47708548 TATTTCCTTGGCATTTTCCCAGG + Intergenic
1109743928 13:66595153-66595175 CATTTCAAAGAGATGTTCCCAGG - Intronic
1112964408 13:105169450-105169472 CCTTTCCTAGGGATTTCCTCTGG - Intergenic
1113945785 13:114043421-114043443 CTTTTTCCAGGGCTGTTCCCAGG - Intronic
1113947390 13:114051747-114051769 AACTTCCCAGGGCTGTTCCCCGG - Intronic
1117623467 14:57611460-57611482 CATTTCCCAGGACTGTTCCCCGG - Intronic
1119770625 14:77218791-77218813 TGTTTCCCAGGGATCCTCCCAGG + Exonic
1120247339 14:82022707-82022729 CATTTCCCAGAGCTTTCCCATGG - Intergenic
1120262100 14:82198815-82198837 CATTTTCCAGGGCTTATCCAAGG + Intergenic
1120612439 14:86658610-86658632 CATTTCCCAAGGAATTTTCCAGG + Intergenic
1120944200 14:89978290-89978312 CATTTAACAGGGATTATCCAAGG - Intronic
1123187749 14:106536673-106536695 CAGTTCCCAGGAATTTGGCCAGG - Intergenic
1125773073 15:42185075-42185097 CCATTCCCAGGCATTTGCCCAGG + Intronic
1126271900 15:46829010-46829032 GCTTTGCCAGAGATTTTCCCTGG + Intergenic
1126864559 15:52922854-52922876 CATCTTCCTGGGCTTTTCCCAGG - Intergenic
1127300612 15:57650004-57650026 CATTTGCCAGTGACTATCCCAGG - Intronic
1127671693 15:61200816-61200838 CATCTGCCAGGGCTTCTCCCAGG + Intronic
1128316646 15:66663699-66663721 CAGTTCCTAGGTATTTACCCAGG - Intronic
1130965691 15:88695918-88695940 CATGTCCCACGGCTTTTACCTGG + Intergenic
1132536447 16:483660-483682 CCCTTCCCAGGTCTTTTCCCTGG + Intronic
1133335914 16:5006679-5006701 CTTTTCCTAGGAATTTTTCCAGG + Intronic
1135849832 16:25953242-25953264 CATTTCACAAAGATCTTCCCTGG - Intronic
1137458969 16:48640516-48640538 AATTTCCCAGTGATCTTACCAGG - Intergenic
1139959547 16:70709857-70709879 CATTTCCCTGGCCATTTCCCTGG - Intronic
1140692942 16:77501793-77501815 GGTTACCCTGGGATTTTCCCTGG + Intergenic
1140984541 16:80145684-80145706 AATTTCCAAGGGAGTGTCCCAGG + Intergenic
1143985644 17:10911386-10911408 CTTTTCCCAGGCATTTTCATAGG + Intergenic
1144114774 17:12077338-12077360 TATTTCCCAGGGATTCTCAAAGG - Intronic
1147412330 17:40262655-40262677 ACTTTCCCAGGGTATTTCCCTGG + Intronic
1147835827 17:43330952-43330974 CATTTGCCAGGGAATTGTCCAGG + Intergenic
1147936244 17:44012867-44012889 CAGTTCCCTGGGAATTGCCCTGG - Intronic
1147977132 17:44254426-44254448 CCTTTCCCTGGCATTCTCCCAGG - Intronic
1149383284 17:56116091-56116113 CATTTCCCAGCCATGTCCCCAGG + Intronic
1155160105 18:23188847-23188869 CATCTCCCAGAGATCTTCCTTGG + Exonic
1156450561 18:37264101-37264123 CATCTCCCAGCTATTCTCCCTGG + Intronic
1157732908 18:50020223-50020245 CACTCCCCAGGGATTTGCCAGGG + Intronic
1158422558 18:57308828-57308850 TATGTCCCAGGCATTGTCCCAGG + Intergenic
1158959201 18:62574635-62574657 CATAACCCAGGTAGTTTCCCAGG + Exonic
1159902983 18:74065266-74065288 CAGTTTCCATAGATTTTCCCAGG + Intergenic
1160738254 19:674535-674557 CATTCCCCCGGGACTCTCCCGGG - Intergenic
1161799977 19:6412176-6412198 CATGCCTCTGGGATTTTCCCAGG + Intergenic
1165127592 19:33611377-33611399 TCTTTACCAGGGACTTTCCCTGG + Intergenic
1167855102 19:52230807-52230829 AAATACCCTGGGATTTTCCCAGG + Intergenic
1168134203 19:54339267-54339289 CATTTCCCAGGGCTTGTCCTGGG + Intergenic
925631076 2:5894258-5894280 TTTATCCCAGGGAGTTTCCCTGG - Intergenic
925826413 2:7852456-7852478 CATTTCCCATGGCTGTTGCCAGG + Intergenic
925872624 2:8284229-8284251 CCTTTCCCAGGGATCCTTCCTGG + Intergenic
926611707 2:14954209-14954231 CATGTTCCAGGTGTTTTCCCAGG + Intergenic
927304051 2:21549793-21549815 CAGTTCCCAGTGATTGTCCTAGG - Intergenic
928040653 2:27873079-27873101 CATTTCCTAGGAACCTTCCCTGG + Intronic
928176108 2:29035412-29035434 CATTCCCCCGGGCTCTTCCCTGG + Intronic
929208934 2:39331610-39331632 CATTTCTCATGTATTTTCACAGG - Intronic
929472796 2:42212735-42212757 CATTTTCCAGTGTTTCTCCCAGG + Intronic
932043191 2:68320575-68320597 CATTTCCCAGGTGTGCTCCCTGG - Intergenic
934042449 2:88139268-88139290 TACTTCCCAGGCAATTTCCCTGG - Intergenic
935156544 2:100488387-100488409 CCATTTCCAGGGATTATCCCTGG - Intergenic
937863238 2:126729760-126729782 CCTTCCCCAGGGATTCTGCCTGG - Intergenic
938206454 2:129428531-129428553 CAATTCTCCGGGACTTTCCCAGG + Intergenic
939277943 2:140026090-140026112 CAAAGTCCAGGGATTTTCCCAGG - Intergenic
939431805 2:142119269-142119291 CATTTCCAAGGTAATTTCTCTGG + Intronic
945631416 2:212282718-212282740 AAATTCCCAGGCACTTTCCCTGG - Intronic
946475724 2:220004832-220004854 CCTGTTCCAGGGATTCTCCCAGG - Intergenic
1169277444 20:4243391-4243413 CAATTCCCTGTGATTTTCCGTGG + Intronic
1169899713 20:10540463-10540485 CATTTCCCAGGTATCCTCCTCGG - Intronic
1170254671 20:14326982-14327004 CAATTCCCTGGGGTTTGCCCAGG - Exonic
1170568862 20:17621800-17621822 CAGTTCTCAGGGAATGTCCCCGG - Intronic
1175857169 20:62127992-62128014 CATTTCCCTGGGGTTTTTGCTGG + Intronic
1178031313 21:28529513-28529535 AATTTCCCAGTGGTTTTCCTTGG - Intergenic
1179096460 21:38320429-38320451 CATGTGTCAGGGATTTACCCAGG + Intergenic
1179722475 21:43323595-43323617 CATTTCCCAGGTTATTTTCCTGG + Intergenic
1180298147 22:10962819-10962841 CATATCCTAGGCATTTTCCATGG - Intergenic
1181325910 22:22045771-22045793 TGTTTCCCAGGGTTTTCCCCTGG - Intergenic
1182314115 22:29432270-29432292 CAGTTCCCAGGAATTTGCTCAGG + Intergenic
1183255091 22:36756885-36756907 CATTTGCCGGGCATTTTCCTAGG - Intergenic
1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG + Intergenic
1184225456 22:43126990-43127012 CACTTCCCTGGGAGTTCCCCCGG + Intronic
952857078 3:37781075-37781097 CATTCCCCAGGGATTTTGTTTGG + Intronic
953534045 3:43763924-43763946 CTTTTCCCAGGCATTTTACATGG + Intergenic
954349198 3:50028627-50028649 CATTACCCAGGCATTTTTTCTGG - Intronic
954948073 3:54444127-54444149 CACTTCCCAGTGAATTTCCTTGG + Intronic
957675628 3:83360503-83360525 CATTTCCCAGTGTCTTTCCCTGG + Intergenic
959867315 3:111285754-111285776 CAGTTCCCAGGGCTTGCCCCAGG - Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962408693 3:135122426-135122448 CATTTCCAGGGGATTTTCAGGGG + Intronic
962967092 3:140365368-140365390 CATTTCAAAGGGATTTTTCAAGG + Intronic
965816832 3:172644731-172644753 CATATGCCAGGGATGTTTCCAGG + Intronic
966365262 3:179178899-179178921 CAGTGCCCAGGGCTTTTACCGGG + Intronic
966569832 3:181429124-181429146 CATTCCCCAGGGGTTTCTCCTGG - Intergenic
966860353 3:184228305-184228327 CTTTTCCCAGGGAATTTCATGGG - Intronic
968737216 4:2303725-2303747 AAATTCCCAGGGGTGTTCCCAGG - Intronic
969511084 4:7618346-7618368 CATCTTCCAGGGCTTTTTCCAGG + Intronic
969660557 4:8525114-8525136 CATCTCCCAGGGATGTGCCCGGG - Intergenic
970210900 4:13708939-13708961 CACTTCCCATGGAAGTTCCCTGG - Intergenic
970726531 4:19052006-19052028 CAATTCCCAGTCATCTTCCCGGG - Intergenic
971990111 4:33881571-33881593 CATTTCCCAAGGTTCTTGCCAGG + Intergenic
972350388 4:38231214-38231236 GATTTCCCAAGCATTTACCCCGG + Intergenic
972655599 4:41060707-41060729 TCTTTCCCAGGGAGTTTTCCTGG - Intronic
973709008 4:53608013-53608035 CATTTCCTAGGTTTTCTCCCAGG - Intronic
974275179 4:59710871-59710893 CAATTCACAGGGATTTGCTCCGG - Intergenic
976315079 4:83651461-83651483 GGTTTGCCAGGGACTTTCCCAGG - Intergenic
979754959 4:124328838-124328860 GAGTTCCCAGGGATGCTCCCAGG + Intergenic
983636100 4:169899268-169899290 CATTTCCAAGGGATTTTTTTAGG - Intergenic
984849481 4:184141567-184141589 CATTTCCCTGCGATGTTCCCTGG - Intronic
985590797 5:764151-764173 CATTTACCAGAGACTTGCCCGGG + Intronic
985681315 5:1257283-1257305 CATGGCCCTGGGAGTTTCCCAGG + Intronic
985879274 5:2626393-2626415 CATTTGCCCGTTATTTTCCCAGG - Intergenic
986734143 5:10655723-10655745 CATTTCCCGGGGATTTGCCCAGG + Intergenic
986946078 5:13022626-13022648 AATTTCCCAGGGATTATAACTGG + Intergenic
987084855 5:14458835-14458857 CCATTCCCAGGGACTTTCTCAGG - Intronic
987770392 5:22294910-22294932 CATTTCATAGGGATTCTCCCAGG - Intronic
990326091 5:54676724-54676746 CACTTGGCAGGGATTTTCCTGGG - Intergenic
992879020 5:81086949-81086971 CATTTCACAGGGACTTACCTTGG - Exonic
994207352 5:97050308-97050330 CCTTTCTCCTGGATTTTCCCAGG - Intergenic
994329310 5:98487425-98487447 TATTTCCCAGGGCTCTTGCCAGG - Intergenic
998168253 5:139856629-139856651 CATTTCCCAGGGCTCTGCCAAGG - Intronic
998730645 5:145071989-145072011 GATGTCCTAGGGATTTTCTCAGG + Intergenic
999061070 5:148636044-148636066 CATGTACCAGGGATTTTGCCAGG + Intronic
999198466 5:149799280-149799302 CATTTCCCAGGGATGAGCACTGG + Intronic
1000146642 5:158459818-158459840 CTTTTCCAAGTGAATTTCCCTGG - Intergenic
1000594956 5:163204341-163204363 CATTTTCCTGTGATTTTCCAAGG - Intergenic
1001403140 5:171458356-171458378 TATTTCCCAGGGCCTGTCCCAGG + Intergenic
1002349405 5:178572975-178572997 CATTTTCCAGGATTTTTCTCTGG - Intronic
1002592370 5:180299616-180299638 CATTTCCCTGGGACTGACCCAGG + Intergenic
1005597034 6:27389285-27389307 CATCTCCCAGGGATACACCCGGG - Intronic
1006473302 6:34240106-34240128 AATTCTCCAGGGATTTACCCTGG + Intronic
1006613926 6:35312130-35312152 CCTCTCCCAGGTCTTTTCCCTGG + Intronic
1006921927 6:37633005-37633027 CATTTCCCAGGGACCCTCCTAGG - Exonic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1012480763 6:99664431-99664453 CATTCCCTTGGGATTTTTCCTGG + Intergenic
1013676805 6:112473484-112473506 CATTTCTCAGGGAATTTACCTGG - Intergenic
1014735002 6:125083049-125083071 CATCTCCCAGTGATTCTCCGTGG + Exonic
1017432458 6:154384571-154384593 CATGTGCCAGACATTTTCCCAGG + Intronic
1017860982 6:158397089-158397111 CATTTCCCATGGATTCCCTCTGG - Intronic
1017992611 6:159504512-159504534 CACTTCCCAGGGCTGCTCCCAGG - Intergenic
1018996380 6:168713587-168713609 CATCTCTCTGGGATTTTTCCAGG + Intergenic
1021240312 7:18192468-18192490 GCTTTGCCAGTGATTTTCCCAGG - Intronic
1021532970 7:21670320-21670342 CATTTCCCAGTGTTTTTGGCTGG + Intronic
1021605619 7:22406539-22406561 CTTTTCCCCTGGATTTCCCCAGG + Intergenic
1022496210 7:30854744-30854766 CATTTCCCAGGGCTGTGCCCAGG - Intronic
1026178111 7:68015348-68015370 CATTTCCCAGAGGACTTCCCAGG - Intergenic
1026938765 7:74274580-74274602 GATTTCCCAGGGAGTTCCCCGGG + Intergenic
1028910674 7:96204097-96204119 CATTTACCAGTAATTTTCCAGGG - Intronic
1029164200 7:98575105-98575127 CATTGCCCAGGGATTAAGCCCGG + Intergenic
1030761494 7:113357721-113357743 CAGTTCCCAGGGTTTTTCGGAGG + Intergenic
1031930875 7:127684635-127684657 CATGTCCTAGGCATTATCCCAGG - Intronic
1032088027 7:128893823-128893845 CACTGCCCAGGGATCTTGCCTGG + Exonic
1033455132 7:141496233-141496255 TTTTTCCCAGGGATTTCTCCTGG + Intergenic
1034329509 7:150270181-150270203 AAGTTCCCAGGGATTTTGCCTGG - Intronic
1034668547 7:152839680-152839702 AAGTTCCCAGGGATTTTGCCTGG + Intronic
1034731025 7:153387637-153387659 CCTTGGCCAGGGATTTTCCTGGG + Intergenic
1035205923 7:157293723-157293745 CATTTCCAAGAGGTTTTCCTTGG - Intergenic
1035208539 7:157310819-157310841 CATTTCCAAGAGGTTTTCCTTGG + Intergenic
1035453465 7:158994178-158994200 CATTTCCCAGGTTTTTTCTAGGG - Intergenic
1036824263 8:11964022-11964044 CATTTCTATGGGAATTTCCCGGG - Intergenic
1036961604 8:13250107-13250129 CATGTTCCAGGGATTGTGCCAGG - Intronic
1037124701 8:15333498-15333520 CATTTCACAGGGTGTTTGCCAGG - Intergenic
1038894475 8:31766510-31766532 CATTTCCTAGGGGTTTGCACAGG - Intronic
1038926937 8:32151181-32151203 CATTGCCCAGAGAGATTCCCAGG + Intronic
1039744628 8:40413171-40413193 AATTTCCCAGGGCCTTTGCCAGG + Intergenic
1041646256 8:60255470-60255492 CATTTTCCAGGAATATTCCTTGG - Intronic
1045650375 8:104336703-104336725 CATTTCAGAGTGATGTTCCCAGG - Intronic
1045872782 8:106945374-106945396 CAGTACTCAGGGATTTTGCCAGG - Intergenic
1048043750 8:130754306-130754328 CCTTACCCAGGGATCTTCCATGG + Intergenic
1048960355 8:139571699-139571721 CAATGCCCAGGGATTTTCAGTGG - Intergenic
1049215582 8:141406380-141406402 CAGTTCCCTGGGGTTTCCCCTGG + Intronic
1050933945 9:11368881-11368903 CATTTCCCAGGTATTGTGCTAGG + Intergenic
1051131021 9:13861125-13861147 CATGTCCCTGGAATTTTGCCTGG - Intergenic
1052995818 9:34551220-34551242 TATTTCCCACAGTTTTTCCCTGG + Intergenic
1055055002 9:72015307-72015329 AATTTCCCAGGCCTTTTCTCTGG - Intergenic
1055407619 9:75991151-75991173 CATTTACCAGGGACTGACCCTGG + Intronic
1055874434 9:80925027-80925049 CATTTCCCAGAGATGTTCTGGGG + Intergenic
1058706598 9:107642575-107642597 CATTCCCCAGGGCTTGTCTCAGG - Intergenic
1058790884 9:108444477-108444499 CAATTCCCAAGCCTTTTCCCTGG - Intergenic
1061390501 9:130315016-130315038 CCCCTCCCAGGGATTTTCCAAGG - Intronic
1061729738 9:132604578-132604600 AAGTTCCCAGGGACTGTCCCTGG + Intronic
1186094832 X:6089017-6089039 AATTTGCCAATGATTTTCCCAGG - Intronic
1186841882 X:13492788-13492810 CATTTCTCAGAAATTTTCCTAGG + Intergenic
1188951602 X:36382218-36382240 CATTTCCCAGAGATCTTCCACGG - Intronic
1189681570 X:43521841-43521863 AATTTCCCAGTGTTTCTCCCCGG + Intergenic
1189732399 X:44034847-44034869 CATTCCCAAGTAATTTTCCCTGG + Intergenic
1190032467 X:46987555-46987577 CTTTTGCCAGGGATTTTTCTGGG + Intronic
1191044809 X:56124602-56124624 CATTGCCAAGGGATTTTTCTGGG + Intergenic
1192552889 X:72068201-72068223 CAGTTCCCAGGGATCTGCTCTGG - Intergenic
1194426030 X:93739367-93739389 CTTTTCCCAGGGTTTCTCTCTGG - Intergenic
1195550029 X:106157975-106157997 AATATCCCAAGGATTTTCCCAGG + Intergenic
1196267114 X:113662900-113662922 CATTCCCCAGGTATTATTCCTGG - Intergenic
1197641021 X:128968178-128968200 CATTCCCCAAGGCTTTTGCCAGG - Intergenic
1198006124 X:132495454-132495476 CATTTACTAGGGCTTTTCCCTGG - Intergenic
1198953404 X:142099129-142099151 CTTTGCCCAGGGATTCCCCCAGG + Intergenic
1199977422 X:152902597-152902619 CATTTCCCAAGGAGGTGCCCAGG - Intergenic
1200831485 Y:7691163-7691185 CATCCTCCAGGGAATTTCCCAGG - Intergenic
1202161578 Y:21940669-21940691 CATTTCCCTGGGAAAGTCCCTGG + Intergenic
1202229778 Y:22645704-22645726 CATTTCCCTGGGAAAGTCCCTGG - Intergenic
1202313378 Y:23550461-23550483 CATTTCCCTGGGAAAGTCCCTGG + Intergenic
1202557425 Y:26120134-26120156 CATTTCCCTGGGAAAGTCCCTGG - Intergenic