ID: 1080571202

View in Genome Browser
Species Human (GRCh38)
Location 11:33558532-33558554
Sequence AGGAGGGTCTGGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2393
Summary {0: 1, 1: 0, 2: 6, 3: 157, 4: 2229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080571192_1080571202 4 Left 1080571192 11:33558505-33558527 CCGGACAGGGCAGAGAGGGTGGG 0: 1
1: 0
2: 1
3: 40
4: 439
Right 1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG 0: 1
1: 0
2: 6
3: 157
4: 2229
1080571187_1080571202 16 Left 1080571187 11:33558493-33558515 CCTCCAGGGGCACCGGACAGGGC 0: 1
1: 0
2: 2
3: 29
4: 205
Right 1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG 0: 1
1: 0
2: 6
3: 157
4: 2229
1080571182_1080571202 29 Left 1080571182 11:33558480-33558502 CCACAAGGATCTGCCTCCAGGGG 0: 1
1: 0
2: 1
3: 7
4: 205
Right 1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG 0: 1
1: 0
2: 6
3: 157
4: 2229
1080571188_1080571202 13 Left 1080571188 11:33558496-33558518 CCAGGGGCACCGGACAGGGCAGA 0: 1
1: 0
2: 2
3: 25
4: 249
Right 1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG 0: 1
1: 0
2: 6
3: 157
4: 2229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080571202 Original CRISPR AGGAGGGTCTGGAGGGAGAA GGG Intronic
Too many off-targets to display for this crispr