ID: 1080574254

View in Genome Browser
Species Human (GRCh38)
Location 11:33583891-33583913
Sequence TTGGTAAGTAGCAGAACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080574246_1080574254 21 Left 1080574246 11:33583847-33583869 CCCTCCTTTCACCCATGAAAAGT 0: 1
1: 1
2: 2
3: 31
4: 261
Right 1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG 0: 1
1: 0
2: 3
3: 21
4: 187
1080574248_1080574254 17 Left 1080574248 11:33583851-33583873 CCTTTCACCCATGAAAAGTAACT 0: 1
1: 0
2: 2
3: 19
4: 219
Right 1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG 0: 1
1: 0
2: 3
3: 21
4: 187
1080574249_1080574254 10 Left 1080574249 11:33583858-33583880 CCCATGAAAAGTAACTCTTTCAA 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG 0: 1
1: 0
2: 3
3: 21
4: 187
1080574250_1080574254 9 Left 1080574250 11:33583859-33583881 CCATGAAAAGTAACTCTTTCAAG 0: 1
1: 0
2: 1
3: 21
4: 281
Right 1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG 0: 1
1: 0
2: 3
3: 21
4: 187
1080574247_1080574254 20 Left 1080574247 11:33583848-33583870 CCTCCTTTCACCCATGAAAAGTA 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG 0: 1
1: 0
2: 3
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080574254 Original CRISPR TTGGTAAGTAGCAGAACTGA TGG Intronic
902738309 1:18415887-18415909 TGGGTAATTCCCAGAACTGAGGG - Intergenic
903790562 1:25890097-25890119 CTGGTAAGTAGGAGGACTGGAGG + Intronic
904989347 1:34579071-34579093 TGGGTAATTCCCAGAACTGAGGG + Intergenic
905631026 1:39518661-39518683 TGGGTAAGAAGCAGAGCTGATGG + Intronic
905666734 1:39767515-39767537 TGGGTAAGAAGCAGAGCTGATGG - Intronic
909594022 1:77384862-77384884 TTAGTGAATAGCAGGACTGAGGG + Intronic
910299353 1:85688299-85688321 CTGGAAAGTAGCAGAGCTGCTGG + Intronic
916574111 1:166052007-166052029 GTGGGAAGTAGGAGAACTTAGGG - Intergenic
918981552 1:191566975-191566997 TTGGTGAACAGCTGAACTGAGGG - Intergenic
919647946 1:200114806-200114828 CTAGTAAGTGGCAGAACAGATGG + Intronic
920830462 1:209460366-209460388 TTGTTAAAGACCAGAACTGAAGG - Intergenic
924880368 1:248155076-248155098 TTGATAATCAGCAGGACTGATGG - Intergenic
924885644 1:248213282-248213304 TTTGTAATCAGCAGGACTGATGG - Intergenic
1063342084 10:5275380-5275402 TGGAAAAGTAGCAGAACTCAGGG - Intergenic
1065130320 10:22613482-22613504 TGGGGAGGGAGCAGAACTGATGG + Intronic
1066368619 10:34800121-34800143 TTGGGAAGTTGCACAACTGAGGG - Intronic
1066663704 10:37761294-37761316 TTGGTAACTATAAGAACAGAGGG + Intergenic
1067822652 10:49543470-49543492 TGGGTAATTCCCAGAACTGAGGG + Intergenic
1070501393 10:77075968-77075990 TGGTGAAGTAGCAGAAATGAAGG - Intronic
1071481224 10:86066506-86066528 TTTATAAGTGGCAGAGCTGAGGG + Intronic
1072117709 10:92379821-92379843 TTGGGCAGTAGCAGAACAGTGGG - Intergenic
1072188846 10:93064741-93064763 CTTGTCAGTAGGAGAACTGAAGG + Intronic
1076494212 10:130886234-130886256 CTGGTCAGTTGCAGAAATGAAGG - Intergenic
1079568457 11:21912888-21912910 TGGGGAAGAAGCAGATCTGAGGG + Intergenic
1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG + Intronic
1081004062 11:37711806-37711828 TTGCTAAGTAGCTGAAGTTAAGG - Intergenic
1081209399 11:40313238-40313260 GTGGTAAGTCACAGAATTGAAGG - Intronic
1086538749 11:87882391-87882413 TTGTCAAGTATAAGAACTGATGG - Intergenic
1087659976 11:100975967-100975989 ATGGTAAGTTGGAGAACAGAAGG + Intronic
1087661950 11:100998816-100998838 CTGGGAAATAGCAGAAATGATGG + Intergenic
1088432055 11:109769291-109769313 CTGGAAAGGAGCAGCACTGAGGG - Intergenic
1089221613 11:116876653-116876675 TAGGTAAGCTGCAGAACTGCAGG + Intronic
1090028176 11:123185344-123185366 TTGTTAAGTGCCAGATCTGAGGG + Intronic
1090689155 11:129159195-129159217 TAACTAAGGAGCAGAACTGAAGG + Intronic
1091072859 11:132585237-132585259 CTGGGAAGTAGCAGAACAGAGGG + Intronic
1091128191 11:133120862-133120884 TGGGTGACTATCAGAACTGATGG - Intronic
1093788277 12:23217032-23217054 TGGGTAATTCCCAGAACTGAGGG + Intergenic
1094614132 12:32021141-32021163 TGGGTAATTCCCAGAACTGAGGG + Intergenic
1095373817 12:41502517-41502539 ATGGTTAGGAGCAAAACTGAGGG - Intronic
1096633246 12:52943152-52943174 TTGTTAGGTCGCAGAACTGATGG - Intronic
1096668906 12:53186167-53186189 TGGGTAAGTATTAGAAATGAAGG + Intronic
1096689123 12:53308648-53308670 TTGGTAAGATGCAGCTCTGAGGG - Intronic
1098994899 12:77107846-77107868 TTGGTAAGATGCAGTACTGAAGG - Intergenic
1102085462 12:110134560-110134582 TTGGTATTTAACAGAACAGATGG + Intronic
1102526186 12:113514117-113514139 TGGGTAATTTCCAGAACTGAGGG - Intergenic
1107237270 13:38186920-38186942 TGGGTAGGTAGGGGAACTGATGG - Intergenic
1107559449 13:41546516-41546538 TTGTTAAGTGGCAGAGCGGAGGG - Intergenic
1108068973 13:46607933-46607955 TTTGTATGAAGCAGAACTGAGGG + Intronic
1108354452 13:49617678-49617700 ATGGAAAGTAGCAGAGCTGGGGG + Intergenic
1109101288 13:58186555-58186577 GGGGTAAGTAGCACAAATGAGGG + Intergenic
1109261738 13:60152815-60152837 TTAGTAAGTATCAGTAGTGAAGG - Intronic
1109827488 13:67741391-67741413 TGGGTAATTCCCAGAACTGAGGG - Intergenic
1110080708 13:71307057-71307079 GTGATAATAAGCAGAACTGAAGG - Intergenic
1111993560 13:95140087-95140109 TTTGGAAGAAGCAGAACTGAAGG - Intronic
1112721059 13:102245941-102245963 GTGGTAAGTAGGAAAAATGAAGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115057517 14:29148350-29148372 TAGGTAGGCAGCAGAACTGAAGG - Intergenic
1115209280 14:30949175-30949197 TGGATAACTAGCAGAATTGAAGG - Intronic
1116897340 14:50329813-50329835 TATGTAAGTAGCCGAACTTATGG - Exonic
1118578442 14:67268547-67268569 TGGGCAATTCGCAGAACTGAGGG + Intronic
1119732485 14:76959588-76959610 TTTGTAGGTAGCAGAAGGGAAGG - Intergenic
1122850050 14:104523149-104523171 TTGGAAGGCAGCAGCACTGAGGG - Intronic
1123961245 15:25403070-25403092 TTGGATATTAGCAGAGCTGATGG - Intronic
1124232631 15:27958459-27958481 TTGGTAAGCAGCAGAAGACAGGG + Intronic
1128811301 15:70574772-70574794 TTGGAAAGTGGCAGAGCTGGGGG + Intergenic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1130394948 15:83493745-83493767 CTGTTAAGTACCAGAACTGCTGG + Intronic
1134418042 16:14061659-14061681 CTGGTAAGTGGTAGAGCTGAGGG - Intergenic
1135153473 16:20031363-20031385 TTGGTAAGTCCCATAAATGAAGG + Intergenic
1136845681 16:33573907-33573929 TTGGAAAGCAGCAGGAATGATGG + Intergenic
1141578749 16:84982866-84982888 CTGGTAAGGGGCAGAGCTGAAGG + Intronic
1203107389 16_KI270728v1_random:1422560-1422582 TTGGAAAGCAGCAGGAATGATGG + Intergenic
1144402747 17:14922091-14922113 TTGCTAAATAGCTGAACTAATGG - Intergenic
1144594274 17:16554035-16554057 TTGGTATGTAGCAAAACTGCTGG - Intronic
1145846000 17:28039945-28039967 CTGGGAAGTAGCAGAAGTGAGGG + Intergenic
1145901709 17:28494254-28494276 TTGAGATGTTGCAGAACTGAGGG + Intronic
1146791453 17:35752984-35753006 GTGGCAAGTAGCAGCACTGGAGG - Intronic
1147463950 17:40596072-40596094 TTGGGAAATAGCAGAACAGTGGG - Intergenic
1152160915 17:78668150-78668172 CTGGTGAGTAGCAGAGTTGATGG - Intergenic
1153364703 18:4242538-4242560 TTGGGAAGTGGCAGAACAAAGGG + Intronic
1153412171 18:4805725-4805747 TTGGTAAGTAAAAGTACTTATGG + Intergenic
1154272529 18:12932460-12932482 CGGGTAAGTAACAGAACAGATGG - Intergenic
1156053470 18:32969028-32969050 TTATTAAGTAACAGAACTGTAGG + Intronic
1156121892 18:33854426-33854448 TTTGTAAATAGCAGAACAAATGG - Intronic
1156175845 18:34545194-34545216 CTGATAAGTAGCAGAGGTGATGG + Intronic
1156942838 18:42791113-42791135 TTGGGAAGCAGCAGGACTGTAGG + Intronic
1157211199 18:45743499-45743521 CTAGTAAGTAGCAGACCTGCTGG - Intronic
1157369644 18:47099051-47099073 TTGGTGAGAAAGAGAACTGAGGG - Intronic
1158909755 18:62048078-62048100 GTGCTCAATAGCAGAACTGAGGG + Intronic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
1168218019 19:54940524-54940546 TTGTCAAGTACCAGAAATGAGGG + Intronic
925157419 2:1658457-1658479 GTGGCCAGTAGCAGATCTGAGGG - Intronic
925811129 2:7701963-7701985 ATGTTATGTAGCAGGACTGATGG - Intergenic
926341438 2:11907963-11907985 TTATTAAGTAGCAGAAATGAGGG - Intergenic
927599926 2:24431827-24431849 TTGGTAAGTAGCAGATCTAACGG + Intergenic
927617644 2:24615451-24615473 ATGGTTAGTATCAGAACTTAAGG + Intronic
928995996 2:37291854-37291876 TTGGCAAGTAGGAGAACTGATGG - Intronic
929534828 2:42774660-42774682 TAGGTAAGTAGCTGAACTGGGGG + Intronic
930378385 2:50596663-50596685 TTTGTATATAGCAGAACAGATGG + Intronic
930504766 2:52269282-52269304 TTGGAAAATAGCAGAAGTTAAGG + Intergenic
933318652 2:80745180-80745202 TTGGTAAAATGCAGAACTGATGG + Intergenic
935661172 2:105468194-105468216 TTGGCAATTCCCAGAACTGAGGG - Intergenic
936899373 2:117466740-117466762 ATGGTAAATATCACAACTGATGG - Intergenic
938026555 2:127954093-127954115 CAGGTGAGTAGCATAACTGAGGG + Intronic
938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG + Intergenic
940700587 2:157037246-157037268 CTGGGAAGTGGAAGAACTGAAGG + Intergenic
941058776 2:160820881-160820903 TTGGTGAAAAGCAGAAGTGAAGG + Intergenic
941839951 2:170071204-170071226 TTGATACTTAGCAGAACTGCTGG - Intronic
944801354 2:203240164-203240186 TTGAAAAGTAGCTGAACTGCTGG + Intronic
1169273684 20:4219041-4219063 TGGGTAATTCCCAGAACTGATGG - Intergenic
1170439921 20:16368614-16368636 CTGGTAAATATCAGAACAGAAGG - Intronic
1171441093 20:25163683-25163705 TGGGCAATTACCAGAACTGAGGG + Intergenic
1172714393 20:36951904-36951926 GTGGCTAGAAGCAGAACTGAGGG + Intergenic
1173037583 20:39427547-39427569 CTGGCAATCAGCAGAACTGATGG + Intergenic
1173831034 20:46089034-46089056 TTGGTAAATAGCAGTACAGATGG + Intronic
1175276019 20:57771320-57771342 ATGGTAAGTTCCAGAACTGCAGG + Intergenic
1176418479 21:6494860-6494882 TTGGTAATTAGCATAATGGAGGG + Intergenic
1178855959 21:36250605-36250627 TTCATAAGTAGCAAAACAGAGGG + Intronic
1179693972 21:43103182-43103204 TTGGTAATTAGCATAATGGAGGG + Intronic
1181159931 22:20953835-20953857 TTGGTCAGCAGCAGCACTAAGGG - Intergenic
1181284449 22:21741704-21741726 TTGGGAAGAGGCAGGACTGAGGG + Intergenic
1183026019 22:35066476-35066498 TCTGGAAGCAGCAGAACTGAAGG + Exonic
1184695984 22:46139406-46139428 TTGGAAAGCAGCAGGAATGATGG - Intergenic
952742305 3:36746484-36746506 AGGGTAAGTAGGAAAACTGAGGG - Intergenic
955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG + Intergenic
957052753 3:75422749-75422771 TTCGTAAGAACCAGAACTGCTGG + Intergenic
957856983 3:85892146-85892168 CTGGTAAGTACCTGAACTAATGG + Intronic
959513222 3:107237112-107237134 TTGGTAAGCAGGAGAACAGTAGG - Intergenic
960469156 3:118039407-118039429 TTGTTAAGTAACAGTATTGAGGG - Intergenic
961344605 3:126255895-126255917 CTGGTAAGTAGCAGAACAGTGGG - Intergenic
963032309 3:140990657-140990679 TTCAAAGGTAGCAGAACTGAAGG + Intergenic
963164376 3:142185909-142185931 TTGGTAAGTAGGAAACTTGAGGG - Exonic
963457997 3:145571881-145571903 TTGGTAAATATCAGAAATAATGG + Intergenic
966869713 3:184282361-184282383 TTGGTAAGTAGAAGAAGAGATGG + Intronic
974112250 4:57538687-57538709 CTGGTAAGTGACAGAACTGCGGG + Intergenic
974435460 4:61852074-61852096 GTGGAAAATAGCAAAACTGAGGG + Intronic
974822445 4:67084402-67084424 TTGGCAAGTACCAGAACCAAAGG + Intergenic
976423818 4:84877049-84877071 CTGGTACATAGCAGAACTGAAGG + Intronic
976866701 4:89737102-89737124 TAGGTATGTAACATAACTGAGGG - Intronic
978403456 4:108355261-108355283 TTGGTAGGTGGGAGAACTGGAGG + Intergenic
981809980 4:148762885-148762907 TTGGTGTAGAGCAGAACTGAAGG + Intergenic
983252480 4:165360470-165360492 TTGGGATTTAGCAGAAGTGAGGG - Intergenic
985879921 5:2630780-2630802 GTGCTAAGTAGAAGAACTCAGGG + Intergenic
986212103 5:5683664-5683686 TTGGTAACAACCAGAAGTGAGGG - Intergenic
986769493 5:10958850-10958872 TTGAAAAGTAGCAAAACTGGAGG + Intergenic
987373247 5:17212358-17212380 TGGGCAAGTCCCAGAACTGAGGG + Intronic
989088070 5:37696966-37696988 TTAGTAAGTAGTAGAGCTGGGGG - Intronic
990962063 5:61404511-61404533 TTGGTAGGCAGCAGACCTTATGG + Intronic
991279283 5:64893022-64893044 TTGGAAAGTAGAAGAGGTGAAGG + Intronic
991364016 5:65849897-65849919 AAGATAAGGAGCAGAACTGAAGG - Intronic
991455723 5:66801393-66801415 CTGGTATGTACCAGTACTGATGG - Intronic
992230417 5:74658130-74658152 TTGGGAACTAGCAGCACTGAGGG + Intronic
993120226 5:83765738-83765760 TTGGGAATTCACAGAACTGAGGG - Intergenic
994774665 5:104026969-104026991 TTGTTCAGCAGCAGGACTGATGG + Intergenic
997287202 5:132688698-132688720 CTGGTGAGTAGCATAACTCATGG + Intergenic
999235275 5:150086804-150086826 TTAGTCAGTAGCACAAATGAGGG + Intronic
999843277 5:155451524-155451546 ATAGTAAGTAGCAGAGGTGAAGG + Intergenic
1000170640 5:158700130-158700152 TAGTTTAGTAGCAGAAGTGATGG - Intronic
1000189728 5:158898627-158898649 TTTGAAAATAGCAGAAGTGAAGG - Intronic
1003810300 6:9772514-9772536 TTGGTAGGTAGCAAAGCTAAGGG + Intronic
1004174309 6:13325933-13325955 TTGATAAGTAGAGGAATTGAGGG - Intronic
1007520699 6:42450434-42450456 TTGGCAAGTGCCAGTACTGAAGG - Intronic
1008470946 6:51884188-51884210 TTTGTAAGTAGCATAAATTAAGG + Intronic
1010189057 6:73175972-73175994 TTGCAAAGAAGCAGAAGTGAAGG + Intronic
1012589716 6:100966529-100966551 TTGGAAAGCAGCAGAAATCAAGG + Intergenic
1012720898 6:102743139-102743161 TCCGTAAGTTGCAAAACTGAAGG + Intergenic
1012822038 6:104097391-104097413 TTGGTAGGAAACAGAACAGATGG - Intergenic
1013523511 6:110954190-110954212 TGGGCAATTCGCAGAACTGAGGG - Intergenic
1013618921 6:111871057-111871079 TTTATAAGTAACAGAACTGTAGG - Intronic
1014189912 6:118483398-118483420 TTGGAAAGCACCAGAACTGGGGG + Intronic
1016255582 6:142101451-142101473 TTGGGAAATAGCAGAACAGTGGG + Intergenic
1018053473 6:160031695-160031717 TTAGTAAGTTGCAGAGCTGCAGG - Intronic
1020429595 7:8105430-8105452 TTGGTAAGAAACTGATCTGAGGG - Intergenic
1020601317 7:10277663-10277685 TTGGTAAGTATTGGAATTGAAGG - Intergenic
1021327298 7:19289537-19289559 ATGGTAAGTAAGAAAACTGATGG - Intergenic
1021518820 7:21517835-21517857 TTGGTAGGTAGCTGAAAAGAGGG - Intergenic
1021775275 7:24048488-24048510 GTGGTATGTAAGAGAACTGATGG + Intergenic
1022056143 7:26736448-26736470 TTGGCAATTCTCAGAACTGAGGG - Intronic
1022357682 7:29631083-29631105 TGGGCAAGGAGCAGAACAGATGG + Intergenic
1022509161 7:30924126-30924148 TTGGGAGCAAGCAGAACTGAAGG - Exonic
1023027541 7:36064526-36064548 TGGGTAATTCCCAGAACTGAGGG + Intergenic
1023982992 7:45080452-45080474 TTATTGAGTAGCAGAGCTGAGGG + Exonic
1032379396 7:131460876-131460898 TTCGTAAGTGGTAGAAGTGAAGG - Intronic
1033164473 7:139027831-139027853 TTTGTATATAACAGAACTGAAGG + Intronic
1033601832 7:142894094-142894116 CAGGGAAGGAGCAGAACTGAGGG + Intergenic
1034272310 7:149809193-149809215 TTGGTAAGAATGAGAACTGGAGG - Intergenic
1034281799 7:149859738-149859760 TTTGTAAGCAGAAGTACTGATGG + Intronic
1036733817 8:11289308-11289330 CTAGTAAGAGGCAGAACTGAAGG - Intronic
1038491754 8:27976737-27976759 TGCGTAAGTAGCAGAGCTGGAGG - Intronic
1040402798 8:47069438-47069460 TTGGGAAGTAGTAGAACAGTGGG - Intergenic
1044603911 8:94032630-94032652 TTAGTAAGTAGCAACATTGAGGG + Intergenic
1048384041 8:133894549-133894571 CTGGTAAATAGAAGAGCTGAGGG - Intergenic
1050030011 9:1375998-1376020 TGGGCAATTCGCAGAACTGAGGG + Intergenic
1050484435 9:6118685-6118707 TTGATAGGTAGAAAAACTGATGG - Intergenic
1051026753 9:12622317-12622339 TTTTTAAATAGCAGAACTGTTGG + Intergenic
1052780931 9:32781942-32781964 TTGGAAGGAAGCAGATCTGAGGG - Intergenic
1054969225 9:71065455-71065477 CTGGTCAGTAGCAGCACAGATGG - Intronic
1056881351 9:90396596-90396618 CTGGTAAGTAGCAAAACTACTGG + Intergenic
1058225842 9:102362318-102362340 TTGAGATGTAGCAGTACTGAAGG - Intergenic
1058860301 9:109111341-109111363 TTAGTAAGAAGCTGAACTGGAGG + Intronic
1060180709 9:121531772-121531794 ATGGTCAGCAGCAGGACTGAGGG + Intergenic
1061099839 9:128484316-128484338 TGGGTAATGAGGAGAACTGAGGG - Intronic
1061416872 9:130451795-130451817 TTGGCAAGGAGCAGTTCTGATGG + Exonic
1186557252 X:10572927-10572949 CTAATAAGTAGCAGAACTGCAGG - Intronic
1188370034 X:29358656-29358678 ATGATAAGTAGCAGAGTTGATGG - Intronic
1189001709 X:36954929-36954951 CTGGGAAATAGCAGAACTGCGGG - Intergenic
1191224653 X:58030770-58030792 TTGGTAATGAGCAGAGGTGAAGG + Intergenic
1192047669 X:67693627-67693649 TTGTTAAGAAGTAGAACTAAGGG + Intronic
1192269190 X:69562777-69562799 TTGGTAAGCAGCAGAACTTTGGG - Intergenic
1196275127 X:113757786-113757808 TTGGCCAGTAGCAGAAATGAGGG + Intergenic
1197159344 X:123306497-123306519 TTGGAAAGTAGAAGAAGAGAGGG + Intronic
1197530354 X:127616631-127616653 TTGGGGAGAAGCAGAACTGGTGG - Intergenic