ID: 1080576079

View in Genome Browser
Species Human (GRCh38)
Location 11:33600433-33600455
Sequence ATGGACAGTGAAGCCATATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080576079 Original CRISPR ATGGACAGTGAAGCCATATG GGG Intronic
900462556 1:2808641-2808663 TGGGACAGGGAAGCCATAGGAGG - Intergenic
901347138 1:8555136-8555158 ATGGCCAGAAAAGCCATATCTGG + Intronic
906090650 1:43176744-43176766 ATGGAAAGTGAAGCCGTTGGGGG + Intronic
907536779 1:55168742-55168764 TTGAGCAGTAAAGCCATATGAGG - Intronic
908800514 1:67875413-67875435 AAAGAAAGTGAAGCCAGATGAGG + Intergenic
916934544 1:169613978-169614000 GTGGACAGAGAAACCCTATGTGG + Intronic
918379143 1:183937218-183937240 ATGCACCATGCAGCCATATGGGG - Exonic
919351146 1:196455602-196455624 ATGGACTTTGAAGATATATGTGG - Intronic
923145518 1:231195017-231195039 AAGGACAGTGAAGCCAGGTGGGG - Intronic
923539029 1:234875079-234875101 ATGGAGACAGAAGCCATGTGGGG + Intergenic
923984298 1:239363420-239363442 TTGGACAGTACAGCTATATGTGG - Intergenic
924900425 1:248392334-248392356 ATGGAATGTGAAGCCACTTGTGG + Intergenic
1065248577 10:23785871-23785893 AAGGAACATGAAGCCATATGGGG + Intronic
1065864635 10:29903402-29903424 ATGAACAGATAAGCCAAATGAGG - Intergenic
1069960462 10:72076066-72076088 AGGGACAGAGATGCCACATGAGG + Intronic
1070778465 10:79123900-79123922 ATTGACAGGCATGCCATATGCGG - Intronic
1071419372 10:85476252-85476274 ATGGATTCTGGAGCCATATGAGG + Intergenic
1073035767 10:100563172-100563194 ATGCTCAGTGAAGCCCCATGGGG + Intergenic
1073540414 10:104312941-104312963 AGGGCCAGTGAAGCCACAGGTGG + Exonic
1074311664 10:112327896-112327918 AGGGGCAGTGAAGTCATGTGTGG + Intergenic
1075883454 10:125875428-125875450 AAGGACAGAGAAGCCACATTGGG + Intronic
1080576079 11:33600433-33600455 ATGGACAGTGAAGCCATATGGGG + Intronic
1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG + Intronic
1080924987 11:36747028-36747050 CTGGACAGTGGAGCCATAGAAGG - Intergenic
1084356259 11:68640814-68640836 TTGGACAGTGATGCCAACTGAGG - Intergenic
1089657496 11:119961553-119961575 ATGCACAGGGAAGCCATGGGAGG + Intergenic
1093088003 12:14888063-14888085 ATGGACAGGAAAGGCAGATGAGG - Intronic
1095924069 12:47561066-47561088 AGAGGCAATGAAGCCATATGTGG + Intergenic
1099724692 12:86411344-86411366 ATGGATAGTGAAGCATTCTGAGG + Intronic
1102778854 12:115545877-115545899 ATGGACACTGCTGCCATGTGAGG + Intergenic
1106729253 13:32522187-32522209 TTGGGAAATGAAGCCATATGTGG - Exonic
1106825533 13:33516651-33516673 ATGGACAGAGAAGCTCTAGGTGG - Intergenic
1106985766 13:35347405-35347427 CTGGACAATGAAGGAATATGAGG + Intronic
1106998839 13:35520953-35520975 ATGGACAAAGAAGGCATGTGAGG - Intronic
1108272459 13:48774844-48774866 ATGGACTGTGAGGCCCTGTGAGG - Intergenic
1108284233 13:48890187-48890209 ATGGACAGAGATGAAATATGAGG - Intergenic
1109049670 13:57462556-57462578 ATGAATAGTGAAGCAATAAGAGG + Intergenic
1109847299 13:68011975-68011997 ATGGAAAGTGAAATCAAATGTGG + Intergenic
1110437818 13:75495029-75495051 ATGAAAAATGAAGCCATCTGAGG + Intergenic
1113529188 13:111007748-111007770 ATGTACACTGAGGCCATTTGGGG - Intergenic
1115877419 14:37876195-37876217 AGGGACATTGAGGCCAAATGGGG + Intronic
1117303472 14:54450716-54450738 ATCGACATTGAAACCAGATGTGG + Intergenic
1118753839 14:68824198-68824220 ATGGACAGGGAAGGCCAATGGGG + Intergenic
1120938746 14:89924743-89924765 ATGGAAAGCAAAGCCACATGTGG + Intronic
1121922976 14:97900335-97900357 AAGGACTGTGAAGACATTTGTGG + Intergenic
1122194420 14:100074332-100074354 ATGAACAGCAAATCCATATGAGG - Intronic
1122555466 14:102576989-102577011 ATGAACAGGGAAGCCAAATGGGG + Intergenic
1122916546 14:104861727-104861749 ATGGACAGTGGAGACAGAGGGGG - Intergenic
1123977672 15:25568433-25568455 ATGGAAAGAAAAGACATATGGGG + Intergenic
1125897462 15:43314700-43314722 ATGGACAGGGAAGGAAAATGGGG + Intergenic
1129142119 15:73608999-73609021 ATGGACGTTGAAGCCATGGGAGG + Intronic
1133141246 16:3746288-3746310 CTGGGCAGAGAAGCCAGATGAGG - Intronic
1135463521 16:22665307-22665329 ATGGAAAATAAAGCCATCTGTGG + Intergenic
1138128628 16:54459361-54459383 AAAGAAAGTGTAGCCATATGTGG + Intergenic
1138136267 16:54525686-54525708 ATGGAGAGAGAAGTCACATGGGG - Intergenic
1141860890 16:86715398-86715420 GTGGAGAGTGAAGGCACATGTGG + Intergenic
1145377898 17:22368472-22368494 ATGGAAAATGAAGCCAGGTGTGG + Intergenic
1147162111 17:38574321-38574343 ACGGACACTGAAGCCTGATGAGG + Intronic
1148137746 17:45305895-45305917 GTGGACACAGAAGCCAGATGGGG - Intronic
1148387335 17:47243707-47243729 ATGGGCAGTGATGCCCTTTGTGG + Intergenic
1148512288 17:48181784-48181806 ATGGCCAGGGAAGCCTTATCTGG - Intronic
1150893108 17:69177661-69177683 ATGTATAGTGAGGCCAGATGTGG + Intronic
1152332010 17:79678897-79678919 GTGGCCTGTGGAGCCATATGGGG - Intergenic
1153105788 18:1524453-1524475 TTGGACAGAGAAGCCACATGTGG + Intergenic
1154103859 18:11502574-11502596 ATGGGCAGTGAAGTCACATTTGG + Intergenic
1157764502 18:50286503-50286525 ATGGACAGGGAAGGCAGGTGGGG - Intronic
1158680749 18:59564728-59564750 ATGAACACTGAGGCCATATGAGG + Intronic
1159963929 18:74577966-74577988 ATGGGTAGTGAAGGCATCTGAGG + Intronic
1160830095 19:1100169-1100191 ATGGAGAGTGAAGGCTGATGGGG + Intergenic
1162674340 19:12287211-12287233 GTGGACAGTGAAGACTCATGGGG - Intronic
1163484752 19:17579206-17579228 ATCGAATGTGAAGCCAAATGGGG + Intronic
1164073882 19:21795177-21795199 AGAGACAGGGAAGCCATTTGAGG + Intergenic
1164916112 19:32053467-32053489 ATGGAGAGAGATGCTATATGTGG + Intergenic
1165974508 19:39663450-39663472 ATGGAAATTGGAGCCATGTGTGG + Intergenic
1167673420 19:50869918-50869940 AGGCACAGTGAAGCCAGATGTGG - Intronic
1168518698 19:57031320-57031342 ATGAACAGTGTAGCCGTGTGAGG - Intergenic
925524123 2:4780913-4780935 ATAGACAATGAAGCCAGCTGTGG - Intergenic
927005063 2:18839983-18840005 TTGGACAGTTAAGCCATGTCAGG + Intergenic
931058478 2:58499820-58499842 ATGGACAGAAAAGGAATATGAGG + Intergenic
931938270 2:67222895-67222917 CTGGACAGAGAGGCCACATGGGG + Intergenic
933814941 2:86059082-86059104 AGGGACAGTTAAGTCATCTGTGG + Intronic
935363674 2:102268257-102268279 AAGGACAGTGAAGAGATGTGTGG - Intergenic
937871850 2:126791883-126791905 ATGGATCGTTAAGCCATGTGAGG - Intergenic
941865858 2:170333674-170333696 AAGGAGAGTGAAGCCATTTTAGG - Intronic
947274268 2:228372777-228372799 CTGGGGAGGGAAGCCATATGTGG + Intergenic
1171792573 20:29541580-29541602 ATGGAAAATGAAGCCAGGTGTGG + Intergenic
1171855896 20:30342788-30342810 ATGGAAAATGAAGCCAGGTGTGG - Intergenic
1172748557 20:37232645-37232667 ATGGACTGTGATGCCGTAGGAGG + Intronic
1177302925 21:19273366-19273388 ATGGCAAGTGCAGCCATATGTGG - Intergenic
1178385418 21:32145072-32145094 ATGAACAGTTAGGCCAGATGTGG - Intergenic
1181872557 22:25911501-25911523 CTGGAGAGTGGAGCCTTATGGGG + Intronic
949410266 3:3755920-3755942 ATGGCAGGTCAAGCCATATGTGG - Intronic
951301479 3:21003316-21003338 AAGGACAGTAAAGCAATTTGGGG + Intergenic
952985028 3:38771389-38771411 AATGACAGTGAAGACATATCTGG + Exonic
953609556 3:44436298-44436320 ATGGACAGTGCAGCCAAAGCAGG - Intergenic
954613786 3:51959397-51959419 CTGGACAGAGAAGCCCTGTGGGG + Exonic
959865915 3:111270048-111270070 AGGGACAGTGAGGGCAAATGAGG - Intronic
960653336 3:119976339-119976361 ATGAACAGATAAACCATATGTGG + Intronic
960755680 3:121009402-121009424 ATGGACAGAGAAGTAATGTGAGG - Intronic
961312293 3:126010717-126010739 CTTGTCAGTGAAGCCATGTGGGG + Intronic
963244003 3:143043592-143043614 ATGGAAAGTGCAGCCTAATGGGG - Intronic
963382755 3:144552813-144552835 GTGGACAGAGTAGCCATATAAGG + Intergenic
970011336 4:11462848-11462870 AAGGGCAGTGAAGGGATATGGGG + Intergenic
971450087 4:26791978-26792000 ATGGACAGAGCAGCCATCAGAGG + Intergenic
975959164 4:79879902-79879924 ATGGAGAGTGCAGCTAGATGGGG + Intergenic
976211608 4:82676858-82676880 ATTGACAGTGCAGCAAAATGTGG + Intronic
978085442 4:104646492-104646514 TTCGACAGGGAGGCCATATGAGG - Intergenic
978359711 4:107917420-107917442 ATGCACATTTAATCCATATGTGG + Intergenic
978359718 4:107917564-107917586 ATGCACATTTAATCCATATGTGG + Intergenic
979780545 4:124646463-124646485 ATAATCAGTGAAGCCAGATGTGG - Intergenic
980596722 4:134964363-134964385 AGGGACAGTGGAGACATCTGAGG + Intergenic
980692923 4:136319694-136319716 ATGGAGAATAAAGCCATATCGGG + Intergenic
981414379 4:144473292-144473314 TTGTCCAGTGAAGCCATCTGTGG - Intergenic
981893584 4:149768939-149768961 ATGGACATTTAAGCTATCTGAGG + Intergenic
984309622 4:178040637-178040659 AAGGACCGTGAAGACAAATGGGG - Intergenic
984725178 4:183013548-183013570 ATGGAGAGGGAAGCCAGATGGGG + Intergenic
985585635 5:732315-732337 ATGAATAGTGAAGCCACATGAGG - Intronic
985600070 5:823741-823763 ATGAATAGTGAAGCCACATGAGG - Intronic
985706161 5:1402472-1402494 GTGGACACAGAAGCCATCTGAGG - Intronic
986788409 5:11137190-11137212 AATGACAGAAAAGCCATATGAGG + Intronic
989175727 5:38523742-38523764 ATGGACTGAGATGCCATATATGG + Intronic
990566033 5:57030205-57030227 ATGCACAGTGTAGCCATTTAAGG + Intergenic
992355209 5:75974592-75974614 ATGAACAGTGATGGCATATTGGG + Intergenic
994733107 5:103517739-103517761 AGGGAAAGTTAAGGCATATGGGG + Intergenic
994967804 5:106696760-106696782 ATTGTCTGTGAAACCATATGAGG + Intergenic
995765003 5:115604808-115604830 ATTGACAGTAATGCCATATTAGG - Intronic
996857100 5:128020504-128020526 ATGGATGGTGAAGCAGTATGGGG - Intergenic
997908219 5:137841863-137841885 ATGGACTGTGAGGTTATATGGGG + Intergenic
1000825406 5:166038243-166038265 GTGGTGAGAGAAGCCATATGGGG - Intergenic
1001340669 5:170841904-170841926 ATGGACTGTTAAACCATATTAGG - Intergenic
1002545417 5:179939984-179940006 ATGAGCAGTGGAGGCATATGAGG - Intronic
1004292056 6:14376446-14376468 ATAGACCGTGAAGCCTTCTGAGG - Intergenic
1006833730 6:36984850-36984872 AGGGACAGTGGAGACATAGGTGG - Intronic
1007825590 6:44598493-44598515 ATGGAAAGTCAAGTTATATGGGG - Intergenic
1008179656 6:48312643-48312665 ATGGACAGTGAAGAGAAATGAGG - Intergenic
1011714754 6:90093606-90093628 TTGGACAGTGCAGCCCTAGGTGG + Intronic
1012535599 6:100292857-100292879 ATTTACAATGAAGGCATATGAGG + Intergenic
1014762950 6:125377921-125377943 ATTGGAAGTGAAACCATATGTGG - Intergenic
1016827982 6:148405598-148405620 ATGGAGAGCCAAGCAATATGAGG - Intronic
1019800916 7:3087766-3087788 AAGGAGAGTGAGGCCAGATGTGG + Intergenic
1021726030 7:23548864-23548886 ATGGACACTGGAGACAGATGGGG + Intergenic
1025860859 7:65326239-65326261 ATAGAAAGTGAAACCATATTGGG - Intergenic
1026398597 7:69985554-69985576 ATGGCCTATGAAGCCGTATGTGG + Intronic
1027200637 7:76061950-76061972 GAGGACAGAGGAGCCATATGTGG - Intronic
1027658718 7:80963110-80963132 ATGCACAGTGAAGACACAAGTGG - Intergenic
1035272229 7:157727243-157727265 ATGGACAGAGGAGCAAAATGTGG + Intronic
1036942466 8:13064823-13064845 ATCAAAAGTGCAGCCATATGTGG + Intergenic
1038117071 8:24569037-24569059 AGGGACAGAGAAGCCAGAAGTGG - Intergenic
1042360689 8:67879395-67879417 AATGACAGTGAACCCATAGGAGG + Intergenic
1045340971 8:101254229-101254251 GTGTACATTTAAGCCATATGTGG - Intergenic
1046718438 8:117592442-117592464 AGGGAAAGTGAAGCCCTATCAGG + Intergenic
1047698097 8:127423213-127423235 AAGGACAATGAAGCCAAATGTGG + Intergenic
1047882257 8:129208611-129208633 ATGGAAAGTGAACAAATATGTGG + Intergenic
1048158444 8:131987125-131987147 AAGGAAAGTGAAACCTTATGTGG + Intronic
1050252550 9:3760355-3760377 TTGGCCAGTGAAGTCAAATGAGG + Intergenic
1050854098 9:10328938-10328960 TTGCACAGTGTAGCCATATCTGG - Intronic
1052102672 9:24468962-24468984 ATGGAGAGTGAATCCATAGGGGG - Intergenic
1053650585 9:40164747-40164769 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1053755153 9:41299177-41299199 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1054331095 9:63756518-63756540 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1054533998 9:66211455-66211477 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1059348528 9:113648539-113648561 AGGGACAGAGAAGTCCTATGGGG - Intergenic
1060358996 9:122937047-122937069 ATTTAAAGTGAAGCCAAATGTGG + Intergenic
1202798469 9_KI270719v1_random:149438-149460 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1187053452 X:15717012-15717034 TTGGCCTGTGAAACCATATGTGG - Intronic
1187506320 X:19881282-19881304 ATGTACAGTCAAGCCCTAAGTGG - Intronic
1187940886 X:24380012-24380034 ATGGACAGTGTAGCCTAATGCGG + Intergenic
1188676012 X:32940584-32940606 ATGGACTGGCTAGCCATATGTGG + Intronic
1192285769 X:69734043-69734065 TTTGCCAGTGAAGTCATATGGGG + Intronic
1192544086 X:71998401-71998423 ATGGTCAGAGAAGGCATCTGAGG + Intergenic
1194011768 X:88570331-88570353 ATGGCCAATGAAGGCAAATGAGG - Intergenic
1194197200 X:90909333-90909355 AGGAACAGTGAAGTCATATTTGG + Intergenic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic
1195848195 X:109251739-109251761 ATTAACAGTGAAGCCATCAGGGG + Intergenic
1196387834 X:115177582-115177604 TTGGACAGTGAAGCTATAAAGGG - Intronic
1196411545 X:115425143-115425165 ATAGACAGTGAGGCCATTTAGGG - Intergenic
1198429634 X:136552863-136552885 ATAGACAGTGAACTCATGTGTGG - Intronic
1199274312 X:145923749-145923771 CTGGAGAGGGAAGCCATGTGTGG + Intergenic
1200543054 Y:4483536-4483558 AGGAACAGTGAAGTCATATTTGG + Intergenic