ID: 1080576316

View in Genome Browser
Species Human (GRCh38)
Location 11:33602974-33602996
Sequence CACCTTACCCCGTTCAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080576308_1080576316 18 Left 1080576308 11:33602933-33602955 CCCAAGGTGTCATTTTCCTGTCC 0: 1
1: 0
2: 4
3: 21
4: 206
Right 1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1080576309_1080576316 17 Left 1080576309 11:33602934-33602956 CCAAGGTGTCATTTTCCTGTCCC 0: 1
1: 0
2: 3
3: 20
4: 244
Right 1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1080576311_1080576316 -3 Left 1080576311 11:33602954-33602976 CCCATTAATGCTATGCTGCCCAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1080576310_1080576316 2 Left 1080576310 11:33602949-33602971 CCTGTCCCATTAATGCTATGCTG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1080576312_1080576316 -4 Left 1080576312 11:33602955-33602977 CCATTAATGCTATGCTGCCCACC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080576316 Original CRISPR CACCTTACCCCGTTCAGTTT GGG Intronic
900459132 1:2792150-2792172 CACCATACCCAGCTCACTTTTGG + Intronic
901345841 1:8541371-8541393 CACCCTTCCCCCTCCAGTTTTGG - Intronic
917136060 1:171789079-171789101 CATTTTGCCCCTTTCAGTTTGGG + Intronic
918370491 1:183856527-183856549 CATCATGCCCTGTTCAGTTTTGG + Intronic
918370593 1:183857553-183857575 CATCATGCCCTGTTCAGTTTCGG + Intronic
922029141 1:221781284-221781306 CACTTGACCCAGTTCACTTTGGG + Intergenic
923196567 1:231674101-231674123 ATCCTTACCTCATTCAGTTTTGG + Intronic
1070056001 10:72935098-72935120 GAACTTACCAGGTTCAGTTTTGG + Intergenic
1071128810 10:82368530-82368552 CTCCTTACCACCTACAGTTTAGG + Intronic
1076043307 10:127269933-127269955 CTCCTGACCACGCTCAGTTTTGG + Intronic
1080571559 11:33561873-33561895 CAGCTTACCCCATTCACTTCTGG - Intronic
1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG + Intronic
1080703484 11:34666342-34666364 CACCCTACCCCCTTTAATTTTGG + Intergenic
1093686910 12:22067073-22067095 CACCATACCCGGCTCATTTTTGG + Intronic
1093718194 12:22408009-22408031 CACCTTAGCCTCCTCAGTTTGGG - Intronic
1097545336 12:60993309-60993331 CATCTAACGCTGTTCAGTTTTGG - Intergenic
1102985833 12:117277838-117277860 CCCCTTTCCCCTTTCAGCTTCGG + Intronic
1105765257 13:23553000-23553022 CACCTTACCCTGGTGAGGTTAGG + Intergenic
1108000937 13:45905092-45905114 CACCATGCCCAGTTCAGCTTGGG - Intergenic
1109117190 13:58403140-58403162 CACCTTACACCCTTCAGAATGGG - Intergenic
1109943929 13:69407070-69407092 CATCAGACTCCGTTCAGTTTAGG - Intergenic
1113393526 13:109920746-109920768 CACCTTACCCTGTTTGGGTTGGG - Intergenic
1116600996 14:46922390-46922412 CAGCCTACACAGTTCAGTTTCGG - Intronic
1126652943 15:50944381-50944403 CACTATACCCCATTCAGTTCTGG + Intronic
1134332985 16:13267392-13267414 CACCACACCCCCATCAGTTTGGG - Intergenic
1138437268 16:57010086-57010108 CACCTTCCCCACTTCAGTTAGGG - Intronic
1138468374 16:57210862-57210884 CACGTTACCCTGTTAACTTTTGG - Intronic
1139563473 16:67758269-67758291 CACCTTTCCTAGTTCAGTATGGG - Intronic
1140526916 16:75630786-75630808 CACCATACCCAGCTCATTTTTGG + Intronic
1142050492 16:87954922-87954944 CACCTCACCCCGTTGACTGTGGG - Intronic
1142994243 17:3751452-3751474 CACCTCAGCCCCTTCAGGTTGGG - Intronic
1143522560 17:7453405-7453427 CACTGTACCCGGCTCAGTTTTGG + Intronic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1154081981 18:11266603-11266625 AAACTTACCCTGTTGAGTTTAGG + Intergenic
1156080925 18:33334266-33334288 GACCTTACCCAGTTCATGTTAGG - Intronic
1157238195 18:45983724-45983746 TTCCTGAGCCCGTTCAGTTTGGG + Exonic
1158950977 18:62494439-62494461 CACCATGCCCAGTTAAGTTTTGG + Intergenic
1167403136 19:49286392-49286414 CACCATCCCCGGTCCAGTTTTGG - Intergenic
1168214844 19:54917851-54917873 CACCTTACACCCTTCAGTGCAGG + Intergenic
929178032 2:39001782-39001804 CAACTGACCCTGGTCAGTTTTGG - Intronic
931772456 2:65509889-65509911 CATCTTACCAAGTTCAGTGTTGG + Intergenic
932952692 2:76312928-76312950 CCCCTTACCCCAGTCAGTTTTGG + Intergenic
1170767304 20:19301161-19301183 CACCTCTCCCTGTTCAGCTTAGG + Intronic
1174531031 20:51214342-51214364 CACTAAACCCCGTTCAGTTTAGG + Intergenic
955859230 3:63310043-63310065 CCCCATACCCAGCTCAGTTTAGG + Intronic
966599164 3:181758135-181758157 CCCTTTACCCAGTTCTGTTTGGG - Intergenic
971877052 4:32320460-32320482 CACCTGACATCGTTCAGTTCTGG - Intergenic
972156139 4:36164558-36164580 CACCTTTCCCCAGTCATTTTTGG - Intronic
974520721 4:62977046-62977068 CACCTTCCCCAGCTCAGCTTAGG - Intergenic
974818138 4:67032511-67032533 CGTCTTCCCCCATTCAGTTTAGG - Intergenic
988312532 5:29579405-29579427 CCCCTTTCCCCATGCAGTTTTGG - Intergenic
996547875 5:124699902-124699924 CACCTTCTCCCTTTGAGTTTCGG + Intronic
998705971 5:144761152-144761174 CACCTTTCCCATTTCAGTCTTGG + Intergenic
1000329448 5:160195606-160195628 CACCTTACCCAGATAATTTTTGG + Intronic
1013082272 6:106823123-106823145 CTCCTTACCCCAACCAGTTTTGG - Intergenic
1013263598 6:108471611-108471633 CACCATGCCCTGTTAAGTTTTGG + Intronic
1023792594 7:43765013-43765035 CACCTGAGCCCGTTGTGTTTCGG + Intronic
1032301072 7:130687702-130687724 CATCTTCCCCAGCTCAGTTTAGG - Intergenic
1035202632 7:157277074-157277096 GACCGTCCCCCGTTCAGTCTGGG + Intergenic
1038677127 8:29633363-29633385 CATTTTACACCGTTAAGTTTGGG - Intergenic
1047058291 8:121192820-121192842 CACCTAATCCCATTGAGTTTTGG - Intergenic
1053106561 9:35414387-35414409 AACCTTAACCCCTTCTGTTTAGG - Intergenic
1057906568 9:98987963-98987985 CACCTGACAACGTTGAGTTTGGG - Intronic
1062221150 9:135415949-135415971 CATCTTACCCAATTCAGCTTGGG + Intergenic
1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG + Intergenic
1195659074 X:107360792-107360814 CACCCTACCCAGTTCAGACTGGG + Intergenic