ID: 1080577188

View in Genome Browser
Species Human (GRCh38)
Location 11:33610697-33610719
Sequence TAGCCCTTCCTTGCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080577188_1080577192 -3 Left 1080577188 11:33610697-33610719 CCTGTCCCAGCAAGGAAGGGCTA 0: 1
1: 0
2: 2
3: 12
4: 140
Right 1080577192 11:33610717-33610739 CTAAGCCAGATGGTTTAAATTGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080577188 Original CRISPR TAGCCCTTCCTTGCTGGGAC AGG (reversed) Intronic
900575051 1:3378948-3378970 TGGACCCTCCATGCTGGGACAGG + Intronic
900608136 1:3532878-3532900 TAGCCCTCCCCTGCAGGGAATGG - Intronic
900759872 1:4463416-4463438 AACCCCTTCCTAGCTGGGGCTGG + Intergenic
901052969 1:6434905-6434927 CAGCCCTGCCTTGATGGAACTGG + Intronic
902065621 1:13683398-13683420 TGGCCCTGCCTTTATGGGACTGG - Intergenic
903022099 1:20401662-20401684 TAGCCCTGCTCTGCTGGGGCTGG + Intergenic
906049024 1:42855411-42855433 TAGTCCTTCCTGGCTGGGTGCGG + Intergenic
907238692 1:53068861-53068883 TACCCCATCCTTGCTGGACCCGG + Intronic
911041892 1:93597893-93597915 TGGTCCTAGCTTGCTGGGACTGG + Intronic
912505144 1:110150950-110150972 CAGCCCTCCCTGGCTGGGGCGGG - Intronic
913607544 1:120479766-120479788 TTGGCCTTCCTTGCTAGGATGGG - Intergenic
914583647 1:149042068-149042090 TTGGCCTTCCTTGCTAGGATGGG + Intronic
915526596 1:156479959-156479981 AAGTTCTTCCTTGGTGGGACTGG - Intronic
915784663 1:158596936-158596958 TAGCACTTGCTTCCTGGCACTGG - Intergenic
917167118 1:172124736-172124758 TAACCCTTCCTTCCTAGGCCTGG + Intronic
919579514 1:199354518-199354540 TAGCCTTTCCTTTCAAGGACAGG - Intergenic
923125682 1:231032772-231032794 TAGGCTCTCCTGGCTGGGACAGG + Intronic
1062836932 10:641749-641771 TTGTCCTTCCTTGTTGGGGCAGG + Intronic
1062906116 10:1180504-1180526 TGGCCCTTCCTGGCTGGGTCAGG + Exonic
1065748700 10:28865346-28865368 TAGCCCCTCCCTGCAGGGAGTGG - Intronic
1067052162 10:43027982-43028004 AAGCCCTTCCTTCCTGGAATGGG + Intergenic
1067832912 10:49620675-49620697 TGGCCTTTCTTTGCTGGCACTGG - Intronic
1075252210 10:120889760-120889782 AACCCTTTACTTGCTGGGACTGG - Intronic
1076401801 10:130189873-130189895 GAGCCCTGCCTGGCTGGGTCGGG + Intergenic
1078519856 11:12054030-12054052 TAGTCTCTCCTGGCTGGGACTGG + Intergenic
1080577188 11:33610697-33610719 TAGCCCTTCCTTGCTGGGACAGG - Intronic
1081819746 11:45980855-45980877 CAGGACTTCTTTGCTGGGACAGG + Intronic
1084333024 11:68440690-68440712 GAGCCCCACCTTGCTGGGGCTGG + Intronic
1090078365 11:123593825-123593847 GAGCCCCTCCTTGCTGTGTCTGG + Intronic
1091704085 12:2681937-2681959 GTGCCTTTCCCTGCTGGGACAGG - Intronic
1091956144 12:4645174-4645196 TACCTCCCCCTTGCTGGGACTGG + Exonic
1092002772 12:5045181-5045203 GAACCCTGCCTTGCTGGGGCAGG - Exonic
1094161611 12:27396817-27396839 TGGCCCTTCCTTGCAGGACCTGG + Intronic
1094327555 12:29256754-29256776 AAGCCCTTCATTGCCGGGGCTGG - Intronic
1099722767 12:86384477-86384499 AAGCCCTGCCTTACTGGGGCTGG - Intronic
1100390347 12:94141589-94141611 TTTCGCTTCCTTGCTGGGACTGG + Intergenic
1101986898 12:109454254-109454276 TGGCCCTTACTTACTGGAACAGG - Intronic
1108272205 13:48772312-48772334 TAGCCCTTCCTTGCTGGCAGGGG - Intergenic
1108592553 13:51924146-51924168 TAGTCATTCCTGTCTGGGACTGG + Intergenic
1116932573 14:50704601-50704623 GAGCCCTTCCTTGCCCGGAGAGG + Intergenic
1119089756 14:71770733-71770755 TAGCCCTTCTGGGCTGGGGCAGG - Intergenic
1119538395 14:75421761-75421783 TAGCCCATCGTGGCTGGGAGCGG - Intergenic
1119860495 14:77932539-77932561 CAGCCCTTCCGTGCTGGGAATGG + Intronic
1120013977 14:79449344-79449366 AGGCCCTTGCTTGTTGGGACTGG + Intronic
1122101161 14:99410757-99410779 TAGCATTTCCTTGCTGTCACTGG + Intronic
1122884082 14:104702879-104702901 AAGCCCTTCCCTGCAGGGTCTGG + Intronic
1125452139 15:39820135-39820157 TTCTCCTTCCTTGCAGGGACAGG - Intronic
1126048345 15:44664844-44664866 TAGCACTTCCAGGCTGGGACAGG - Intergenic
1129189540 15:73929300-73929322 CAGCCCTTACTTGGTGGGCCAGG - Intronic
1131282707 15:91033981-91034003 TAGCCCTTCTTCGATGGGGCGGG + Intergenic
1134446729 16:14336712-14336734 TCACACTGCCTTGCTGGGACAGG + Intergenic
1138030991 16:53559247-53559269 AGGCCCTTCCTTGCGGGGACGGG + Intergenic
1138297768 16:55901377-55901399 TTTCCCTTCCTTTCTGGGAAAGG - Intronic
1138592435 16:58009284-58009306 TTCCCCTTCCTAGGTGGGACAGG + Intronic
1138596012 16:58029283-58029305 TAGCACTTCCATGCTGGCTCCGG + Intronic
1139199813 16:64962844-64962866 TCTCCCTCCTTTGCTGGGACAGG - Intronic
1140270873 16:73465377-73465399 TATCACTTCCTTGGTGGGCCAGG + Intergenic
1140986045 16:80158945-80158967 TACCTCTTCCTGGCTGGGTCAGG + Intergenic
1143205538 17:5137600-5137622 TGGCCCTTCCAGGCTGGGGCTGG - Intronic
1143539626 17:7561464-7561486 AAGCCCTTCCGGGCTGGAACTGG + Exonic
1143597675 17:7925034-7925056 GAGCACTTCCTTGCTGGGTGCGG - Intronic
1144638771 17:16926475-16926497 TAGCCCTTCCTTGCCCTGAAGGG + Intergenic
1144876582 17:18400292-18400314 TGGCCCTTCCAGGCTGGGGCTGG - Intergenic
1144957403 17:19025944-19025966 GAGCCTGTCCTGGCTGGGACTGG + Intronic
1144977753 17:19148572-19148594 GAGCCTGTCCTGGCTGGGACTGG - Intronic
1145155644 17:20544128-20544150 TGGCCCTTCCAGGCTGGGGCTGG + Intergenic
1145761250 17:27426409-27426431 TGGCCCTTCCAGGCTGGGGCTGG - Intergenic
1146161294 17:30560566-30560588 TGGCCCTTCCAGGCTGGGGCTGG - Intronic
1146617652 17:34369724-34369746 TTGCCCATTCCTGCTGGGACCGG + Intergenic
1148715895 17:49715609-49715631 TAGTCCTTACTTGCAAGGACTGG + Intronic
1152181820 17:78827049-78827071 TTGCCCTTGCTTCCTGGGAAAGG - Intronic
1152820666 17:82436134-82436156 AAGGCCATCCCTGCTGGGACTGG + Intronic
1153336524 18:3931203-3931225 TTGCCTTTCCTTGCTTGGAGAGG + Intronic
1153819782 18:8823565-8823587 TTGCCCTTCCTTTCCGGCACTGG + Intronic
1154111001 18:11568309-11568331 GAGCTCTTCCCTCCTGGGACAGG + Intergenic
1154388401 18:13916188-13916210 TAGCCCTTCCCTGCAGGCCCCGG - Intergenic
1156553368 18:38041634-38041656 TAGCCTTTCCCTGATGGGCCTGG + Intergenic
1157293609 18:46426517-46426539 TAGCCCTGCACAGCTGGGACAGG - Intronic
1158015101 18:52774738-52774760 TAGCCTTTGCCTGCTGGGAAAGG + Intronic
1159916757 18:74194828-74194850 TAGTCGTTCCTGGCTGGGTCAGG - Intergenic
1160678251 19:401702-401724 CTGCCCTTCCTGGGTGGGACTGG - Intergenic
1164656145 19:29923463-29923485 TAGTCCTGCCTAGCTGGGACTGG + Intergenic
1164832476 19:31333234-31333256 TCGCCCTCCCTTGGTGGGAGTGG - Intronic
1168139447 19:54375455-54375477 TAGTTCTTCCTTCCTGTGACTGG + Intergenic
1168158538 19:54492642-54492664 TAGCTCTTCCTTCCCGTGACTGG - Intergenic
926213083 2:10885893-10885915 TGCCCCTTCTATGCTGGGACAGG + Intergenic
929664919 2:43826519-43826541 TGGCCCTTCTTTGCTGGCAGAGG - Exonic
932711482 2:74067823-74067845 GAGCCCTTAGTGGCTGGGACAGG + Intronic
934565102 2:95334623-95334645 CAGTCCTGCCATGCTGGGACTGG + Intronic
938070378 2:128305291-128305313 AAACCCCTCCTTGCTGGGCCTGG + Intronic
938689393 2:133773479-133773501 TAGCCATTATTTCCTGGGACAGG + Intergenic
942035666 2:172008402-172008424 TTAACTTTCCTTGCTGGGACAGG - Intronic
942318428 2:174715068-174715090 TATCCCTTCCTCACGGGGACTGG + Intergenic
947962539 2:234251684-234251706 TCTCCCTGCCTTCCTGGGACTGG + Intergenic
948087742 2:235265599-235265621 TGGCCCTGCGTTGCTGGGCCAGG + Intergenic
1169088947 20:2845860-2845882 TAGCACTTACTTCCTGTGACTGG + Intronic
1171447327 20:25214124-25214146 TGGCCCTGACGTGCTGGGACTGG - Intronic
1174986017 20:55452780-55452802 TTGCCCTTCCTTCCTGGCAGGGG - Intergenic
1176199953 20:63855670-63855692 CAGCCCTTCCTTCCTGGGGTGGG - Intergenic
1176919567 21:14670759-14670781 TAGCCCTTCCAGGCTGTGCCTGG - Intergenic
1178699383 21:34820224-34820246 TATCCCTTCCTTGCTGGGTGGGG + Intronic
1182630761 22:31683479-31683501 TACCTCTCCCTTCCTGGGACAGG - Exonic
950460829 3:13121396-13121418 CAGCCCTGCCCTGGTGGGACTGG - Intergenic
950467503 3:13163816-13163838 TGTCCCTTCCTTTCTGGGGCTGG - Intergenic
951889782 3:27557611-27557633 TTGGCCTTCCTTGCTGAGATTGG - Intergenic
953773020 3:45793128-45793150 AAGCCCTTGCTGTCTGGGACAGG - Intronic
962293405 3:134156898-134156920 TATCCCTTACTTGCTGGTTCTGG + Intronic
964826942 3:160838981-160839003 TAGGCCTCCCATGATGGGACTGG + Intronic
965951696 3:174316578-174316600 CAGCACCTCCTTGATGGGACTGG - Intergenic
966464324 3:180212983-180213005 TCTACCTTCCATGCTGGGACTGG + Intergenic
967213712 3:187192179-187192201 TATCCCTTCCTTGATGGAAATGG + Intergenic
969476881 4:7426990-7427012 AAGCCCTTCCTTGGTGGGAGGGG - Intronic
969477657 4:7430694-7430716 TTTCCCATCCTTGCTGGGATGGG + Intronic
969581569 4:8068505-8068527 TAGCTCTCCTCTGCTGGGACAGG - Intronic
969704612 4:8784961-8784983 TAGCCCTCCCTGCCTGGGAGGGG - Intergenic
969742140 4:9036691-9036713 TACCTCTTCCTTGCTGTGTCTGG - Intergenic
977846976 4:101778238-101778260 TACCCCTTCCTTGATGGAAGTGG + Intronic
977989829 4:103427793-103427815 AAGCCCTTCTTTGCTGGGTCTGG - Intergenic
978805422 4:112795328-112795350 TAGCCCTTCGTTCCAGGGAAAGG + Intergenic
982559111 4:156907705-156907727 TAGGCATTCCTGGCTGTGACTGG + Intronic
985658840 5:1145545-1145567 GAGCCCTTCCTGGCTGGTCCTGG - Intergenic
986631966 5:9782495-9782517 AAGCCCTGACTTGCTGGAACTGG + Intergenic
988203256 5:28097458-28097480 TTGCACTTCCATGGTGGGACTGG + Intergenic
989461824 5:41708526-41708548 TACCCATACCTTGCTGGGACAGG - Intergenic
994728264 5:103462055-103462077 CATCCCTTTCTTCCTGGGACAGG + Intergenic
997093676 5:130886321-130886343 TAATCTTTCCCTGCTGGGACTGG + Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1000382796 5:160644281-160644303 TGGCCTTTCCTTGCTGTCACTGG + Intronic
1004715591 6:18213729-18213751 AAGCCCTCGCTTGCTGGCACTGG - Exonic
1006741681 6:36313344-36313366 TGGGGCTTCCTTGCTGGGCCTGG - Intergenic
1013673965 6:112436405-112436427 TAGCCCTGCCTTGGAGGAACAGG + Intergenic
1016367670 6:143337059-143337081 TAGCCCTGCCTTCCAGGCACAGG + Intronic
1018611775 6:165654294-165654316 TGGCCCAGCCTTGCTGAGACTGG - Intronic
1024042797 7:45568128-45568150 TAGCCCTTCCTTTTTGGGGCTGG + Intergenic
1024698523 7:51882145-51882167 TATCCCTCCCTTGCTGGCACCGG - Intergenic
1030514214 7:110520071-110520093 TGCCCCTTCCCTGCTGGGGCAGG - Intergenic
1035170216 7:157013179-157013201 TAGGGCTTCCTGCCTGGGACAGG - Intergenic
1036247336 8:7129242-7129264 TACCTCTTCCTTGCTGTGTCTGG - Intergenic
1036886925 8:12564720-12564742 TACCTCTTCCTTGCTGTGTCTGG + Intergenic
1047245836 8:123143695-123143717 TAACCCTTCCATTCTAGGACAGG + Intronic
1048466156 8:134666132-134666154 TTGCCCCTCCTAGCTAGGACTGG + Intronic
1050362923 9:4847821-4847843 TGGCCATTCCTTGCTGGCCCTGG + Intronic
1053272068 9:36757034-36757056 CAGCCCTTCCATGCTGGGACTGG - Intergenic
1053504231 9:38627507-38627529 AAGCTCCTTCTTGCTGGGACAGG - Intergenic
1057575239 9:96237280-96237302 TGGCCCTTCCAGGCTGGGAAGGG - Intronic
1057802716 9:98199790-98199812 CAGCCCTTCCCTGCTGGGTTAGG - Intronic
1058703462 9:107619940-107619962 TGGCCTGTCCTCGCTGGGACAGG - Intergenic
1186232069 X:7466228-7466250 GGACCCTTCCTTGCTGTGACAGG - Intergenic
1188573145 X:31613704-31613726 TAGCCCTTCCTTCCTTGGCTAGG + Intronic
1192196914 X:69034618-69034640 CAGCCCCTCCTTGCTGAGTCTGG - Intergenic
1195451067 X:105013567-105013589 TAGTCCTTGCTTGCTGGTATGGG + Intronic
1196147745 X:112337948-112337970 AAGTCCTTCCTTTCTGAGACAGG - Intergenic
1196491455 X:116272330-116272352 TATCACTTCCTTGTTGGGAAGGG + Intergenic
1197448520 X:126581224-126581246 TCGCCCCTCCAGGCTGGGACGGG - Intergenic
1199738277 X:150706184-150706206 TAGGGCTTCCATGATGGGACTGG - Intronic