ID: 1080579709

View in Genome Browser
Species Human (GRCh38)
Location 11:33632233-33632255
Sequence CTGTATCCACAGGTGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080579706_1080579709 -10 Left 1080579706 11:33632220-33632242 CCTTGTGTGTTGGCTGTATCCAC 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 138
1080579699_1080579709 30 Left 1080579699 11:33632180-33632202 CCCCAGTCTGTTCCTCTGCATTA 0: 1
1: 1
2: 5
3: 69
4: 549
Right 1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 138
1080579703_1080579709 18 Left 1080579703 11:33632192-33632214 CCTCTGCATTATACACAGGTCTG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 138
1080579700_1080579709 29 Left 1080579700 11:33632181-33632203 CCCAGTCTGTTCCTCTGCATTAT 0: 1
1: 0
2: 1
3: 22
4: 276
Right 1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 138
1080579701_1080579709 28 Left 1080579701 11:33632182-33632204 CCAGTCTGTTCCTCTGCATTATA 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 138
1080579705_1080579709 -9 Left 1080579705 11:33632219-33632241 CCCTTGTGTGTTGGCTGTATCCA 0: 1
1: 0
2: 0
3: 25
4: 205
Right 1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080579709 Original CRISPR CTGTATCCACAGGTGGACTC TGG Intronic
902526820 1:17064301-17064323 CTGTATCCACAGGAAGAGTGAGG + Intergenic
902548595 1:17206005-17206027 CTGTGTCCAGATGGGGACTCGGG + Intronic
903867859 1:26411630-26411652 CCATATCCACGGGTGGGCTCCGG + Intronic
904915483 1:33967433-33967455 CTGCACCCACAGGTGAACCCAGG + Intronic
905116527 1:35646020-35646042 CTGATTCCACAGGGAGACTCGGG - Intergenic
905220583 1:36443950-36443972 GTGCATCCACAGGTTCACTCAGG - Intronic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
907512023 1:54968864-54968886 CTCTGTCCACATGTGGAGTCAGG + Intergenic
908246740 1:62233332-62233354 CAGTCTCCACAGCTCGACTCAGG + Intergenic
913497312 1:119440200-119440222 GTGTATCTACATGTGGGCTCTGG + Intergenic
915318205 1:155041554-155041576 CTGTGTCGACAGGTGGAGTCTGG - Exonic
916626542 1:166564216-166564238 CTGCATCAACAGGTATACTCAGG + Intergenic
916697863 1:167258565-167258587 CTGTATACACATGTGTACACAGG + Intronic
1063178503 10:3573533-3573555 TTCTATCCTCAGGAGGACTCAGG + Intergenic
1063956238 10:11270257-11270279 CCGTGTCCACAGGTGGACAGAGG - Intronic
1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG + Intergenic
1068330605 10:55561701-55561723 CTCTTTCCACAGGTTTACTCTGG - Intronic
1069620309 10:69833432-69833454 CTCTACCCGCAGGTGGACCCAGG - Intronic
1070500016 10:77063814-77063836 GTGGATACCCAGGTGGACTCAGG + Intronic
1070797695 10:79226415-79226437 CCCTATCCACAGGTGCACCCAGG + Intronic
1072920581 10:99573652-99573674 CTGTATCCACATCCTGACTCTGG + Intergenic
1076919374 10:133443475-133443497 AGGTATCCACAGGTGCACACAGG + Intergenic
1078058573 11:8029109-8029131 CTGTGACCAAAGGTGGATTCTGG + Intronic
1078408199 11:11089627-11089649 CTGAAGGCACATGTGGACTCAGG - Intergenic
1078458040 11:11490943-11490965 CAGTACCCAAAGGTGGGCTCTGG + Intronic
1078840910 11:15074901-15074923 CAGTGCCCACAGGTGGACCCTGG + Intronic
1078948041 11:16093978-16094000 CTGTTTGCTCATGTGGACTCTGG - Intronic
1079091896 11:17486532-17486554 CTGTTTGCACACGTGGACTGTGG + Intergenic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1088298896 11:108333630-108333652 CTGGTTCCTCAGGTGGAATCTGG + Intronic
1088693380 11:112346240-112346262 CTGCCTTCACAGGTGGCCTCTGG + Intergenic
1091288213 11:134420953-134420975 TTGTATACACTGGTGCACTCAGG + Intergenic
1095969979 12:47894877-47894899 GTGGATCCACAGGTGGAGGCAGG - Intronic
1100207788 12:92369833-92369855 CTCTACCCATGGGTGGACTCTGG - Intergenic
1100448646 12:94684395-94684417 CTTTCTCCACAGGTGGCCCCTGG - Intergenic
1100735855 12:97530073-97530095 CTGATTCCACAGGTTGACTTGGG + Intergenic
1101187245 12:102292172-102292194 CTGTTTCCCCTGCTGGACTCAGG - Intergenic
1103531982 12:121608784-121608806 GTGTAACCACAGGTGTCCTCAGG + Intergenic
1109782552 13:67130805-67130827 CTGTATGCACCGGTGGGCCCTGG + Intronic
1113225327 13:108153220-108153242 CTCTACCCAGAGGTGGACTCAGG + Intergenic
1114588694 14:23839358-23839380 CTGTATCCAGAGCTAGAGTCAGG + Intergenic
1114693512 14:24606736-24606758 CTCTGTTCACAGGGGGACTCCGG - Exonic
1114696394 14:24631204-24631226 CTCTATTCACAGGGGGACTCTGG - Exonic
1117006279 14:51424303-51424325 CTGTATCCACTTGTGAACTTGGG - Intergenic
1118776279 14:68976312-68976334 CTCTGTCCACTTGTGGACTCTGG + Intronic
1120144784 14:80967926-80967948 CTGAATTCTCAGGTGGTCTCAGG - Intronic
1121967480 14:98324016-98324038 CTGTAACCACAGTTGGCCTCTGG - Intergenic
1122316364 14:100828027-100828049 CCGCAGCCACAGGTGGGCTCTGG + Intergenic
1123438450 15:20272701-20272723 CTGTAACCACAGGTCGCCTGGGG + Intergenic
1127152727 15:56094751-56094773 CACTATCCACAGGTGTAGTCTGG + Exonic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1130214797 15:81958107-81958129 CTGTAGCCAAAGTTGGATTCAGG - Intergenic
1133108340 16:3529071-3529093 TGGTATCCACAGGTGGGTTCTGG - Intronic
1134683861 16:16145361-16145383 CTGCATGCTCAGGTGGAATCCGG + Intergenic
1138539843 16:57681200-57681222 ATGTATCCACAGGGGGAATCTGG - Intronic
1139469072 16:67168819-67168841 CTGTCTGCACAGGGGGCCTCTGG + Exonic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140016063 16:71186781-71186803 CTGTAACCACCTTTGGACTCAGG + Exonic
1146257635 17:31400792-31400814 CTGGCTCCACAGCTGCACTCAGG - Intronic
1146351790 17:32101567-32101589 CGGTTTCCACATGTGGAGTCTGG + Intergenic
1148195461 17:45709725-45709747 CTGTTTCCTCCGGTGGACTTGGG + Intergenic
1154070891 18:11149988-11150010 CTGGGTCCACAGGTGCACACTGG + Intergenic
1156491101 18:37496701-37496723 CTCTATCGACAGCTGGACTGTGG - Intronic
1160775987 19:855946-855968 CTGCCTCCACAGGGGGACTCCGG + Exonic
1161486121 19:4536801-4536823 CTGTATCAGCAGGTGGGCCCGGG + Exonic
1162561138 19:11418785-11418807 CTGGACGCACAGGCGGACTCAGG + Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1166740883 19:45114212-45114234 CTGTGGCCCCAGGTGGATTCTGG - Intronic
927045277 2:19272099-19272121 CTGTTTCCAGAGGTGCGCTCTGG + Intergenic
928572320 2:32622049-32622071 TTCCATCCACATGTGGACTCTGG - Intergenic
931867304 2:66426419-66426441 CTTTCTCCCCAGCTGGACTCGGG - Intergenic
933878562 2:86645210-86645232 CTGTTTCCTCTGGAGGACTCTGG - Intronic
936093152 2:109513765-109513787 CTGTAGCCACAGGCTGGCTCTGG - Intergenic
936098627 2:109554593-109554615 CTGTATCTACAGGTTTTCTCTGG - Intronic
936456033 2:112675051-112675073 CTGAATTCACAGGTGGTGTCTGG + Intergenic
936618723 2:114073589-114073611 CTCCTTCCACAGGTGGACTCGGG - Intergenic
939222044 2:139314836-139314858 ATGTATCCAAATGTGGACTAAGG - Intergenic
946114986 2:217453538-217453560 TTGCATCCACAGGTGCCCTCTGG + Intronic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948778610 2:240303267-240303289 CTGTATCTTCAGCTGGACTGTGG - Intergenic
948792884 2:240388336-240388358 CAGTTTCCCCAGGTGTACTCAGG - Intergenic
948792893 2:240388381-240388403 CAGTTTCCCCAGGTGTACTCAGG - Intergenic
948932451 2:241140797-241140819 CTGTTTCAGAAGGTGGACTCTGG - Intronic
1171150486 20:22822720-22822742 CTGTATCCAGAGCTGGTCTCAGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1175099468 20:56568187-56568209 TTGTATCCACGGGTGGATCCTGG + Intergenic
1175161258 20:57009510-57009532 TTGGATGCACAGGTGAACTCAGG + Intergenic
1175622049 20:60455825-60455847 CTGTATACACAGGTCCACTCTGG - Intergenic
1178902236 21:36606813-36606835 CTGCATCCACAGGGGGACACCGG - Intergenic
1179547726 21:42123974-42123996 CTGTGTGCACAGATGGGCTCTGG + Intronic
1182283830 22:29232544-29232566 CTGTAACCACAGGAGGACAACGG - Intronic
1183285246 22:36958554-36958576 CTGTATCCCCATGAGGAGTCAGG - Intergenic
1183711769 22:39508629-39508651 TTGTATTTACAGGTGGAATCAGG - Intronic
1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG + Intronic
954124070 3:48518424-48518446 TGCTGTCCACAGGTGGACTCTGG - Exonic
954403230 3:50330404-50330426 CTACACCCACAGGTGGACACAGG + Exonic
955613589 3:60782819-60782841 CTGTATCCTCACGTGGACGAAGG + Intronic
959005799 3:101018412-101018434 CTGTGTCCAGATTTGGACTCTGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961147109 3:124603450-124603472 CTGAATCAACAGGTGGGCTCCGG - Intronic
962316608 3:134363432-134363454 CTGAACGCACAGGTGGACTAGGG - Intronic
963351811 3:144160844-144160866 CTGTATCCACAGTTAGAATGTGG + Intergenic
963534155 3:146507095-146507117 CTCAATCCACAGGTGGCCTGTGG - Intergenic
969688452 4:8689967-8689989 CTGGCTGCACAGGTGGAGTCTGG + Intergenic
973718925 4:53704090-53704112 CTGTATCAACAGTTGTACTTCGG + Intronic
977753975 4:100643744-100643766 CTTTCTGCACAGGTTGACTCAGG - Intronic
978995805 4:115150728-115150750 CTGTATCCACTAGTGAATTCAGG + Intergenic
979542498 4:121901361-121901383 CAGTAACCAAGGGTGGACTCAGG + Intronic
983097827 4:163585824-163585846 CTTTATCCACTGGTGGAGGCAGG + Exonic
983916960 4:173302576-173302598 CTGTATCCTCAGGCTGACTTTGG + Intronic
984548306 4:181132491-181132513 CTGTATCCCCAAGTGGGGTCCGG + Intergenic
986211165 5:5674014-5674036 GTGGGACCACAGGTGGACTCTGG - Intergenic
990199123 5:53351542-53351564 CCTTATCCACAGGGGGGCTCTGG - Intergenic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
993722282 5:91333531-91333553 CTGTATCTTCAGGTTAACTCTGG - Intergenic
998511518 5:142718242-142718264 CAGTATCCCCAGGTGTCCTCAGG - Intergenic
1002591739 5:180295362-180295384 CTGCATACACAGCTGGCCTCCGG - Intergenic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003339531 6:5206261-5206283 CTTTATCCACAGGAGGAAGCTGG + Intronic
1006120198 6:31799739-31799761 CTTTATCCACATATGGGCTCTGG - Intronic
1006616097 6:35328078-35328100 CTGTACCCACAGGTGGCAGCTGG - Intergenic
1014383912 6:120778795-120778817 GTGTATCCACAGCAGGCCTCTGG + Intergenic
1015404704 6:132823904-132823926 CTGTAACCACCAGTGGACACTGG + Intergenic
1015732040 6:136358903-136358925 CTCTACCCACAGGGGCACTCAGG - Intronic
1016614142 6:146027942-146027964 CTGTATCCTCAGGAAGAGTCGGG + Intronic
1022927033 7:35066904-35066926 CTGTGTGCACTGGTGGACACTGG + Intergenic
1023891484 7:44394981-44395003 CTGTGTCCACAAGTGTACTTTGG + Intronic
1025098747 7:56117531-56117553 CTGGGGCCACAGGTGGACACAGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1029321357 7:99763455-99763477 CTGTATCCACATATGGACACAGG - Intronic
1030598949 7:111571121-111571143 CTGTACCCACTGGTGGGCTGGGG + Intergenic
1031196576 7:118622229-118622251 CTGTATCCAGAGGATGTCTCTGG - Intergenic
1032565829 7:132941807-132941829 CAGATTCCACAGGTGGACTTGGG - Intronic
1036934793 8:12991010-12991032 CTGTAATCACAGGATGACTCAGG + Exonic
1039515785 8:38132431-38132453 CTGTTCCCACAGGTGGTCTCTGG - Intronic
1042190602 8:66182255-66182277 CTGCTTCCACAGGAGGACTGAGG + Intergenic
1043662214 8:82758144-82758166 CTGTATCCCAAGGTGGAAGCAGG - Intergenic
1046361230 8:113159474-113159496 CTGTAGTCACAGGAGAACTCAGG - Intronic
1046648243 8:116809042-116809064 CTGTCTTCACAGGTGGTTTCAGG + Intronic
1047537365 8:125732083-125732105 CTGTGTCTTCAGGTGGACTGAGG + Intergenic
1048422862 8:134294486-134294508 CTATAGCCACTGGTGGACTTGGG - Intergenic
1049347769 8:142147876-142147898 CTGCTTCCAAAGGTGGACACAGG - Intergenic
1055363571 9:75521229-75521251 CTGTAGCCACAGCTACACTCAGG + Intergenic
1057146025 9:92760118-92760140 CTGACTCCACAGGGGGAGTCTGG - Intronic
1057935980 9:99239365-99239387 CTGGCTCCTCAGGTGGGCTCAGG + Intergenic
1058181416 9:101804857-101804879 CTTTATCCAGAGGTGGTATCTGG + Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1061165326 9:128919061-128919083 CTGTATCCCCATGTGGACAATGG + Intergenic
1061551374 9:131336721-131336743 CTGTTTACAGAGGAGGACTCTGG - Intergenic
1061637143 9:131919336-131919358 CTGTAGCCAAAGGTGAACTCAGG - Intronic
1196035063 X:111135055-111135077 CTCTAGCCACAGGAGGAATCGGG + Intronic
1198112106 X:133510681-133510703 CTGTATACAAAGGAAGACTCTGG - Intergenic
1199866972 X:151860664-151860686 CTGTGTCCACAGAAGGGCTCAGG + Intergenic