ID: 1080580026

View in Genome Browser
Species Human (GRCh38)
Location 11:33634616-33634638
Sequence CACCTAAGACTTCTGTTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080580017_1080580026 27 Left 1080580017 11:33634566-33634588 CCTTAGAGAGCAACAAGTTATGG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 1080580026 11:33634616-33634638 CACCTAAGACTTCTGTTACACGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080580026 Original CRISPR CACCTAAGACTTCTGTTACA CGG Intronic
908997383 1:70172113-70172135 CCCCCAAGACTTCTTTTATAAGG - Intronic
913967583 1:143389863-143389885 GACCTAAGAATTCTGTTCCCTGG + Intergenic
914061956 1:144215453-144215475 GACCTAAGAATTCTGTTCCCTGG + Intergenic
914117194 1:144750901-144750923 AACCTAAGAATTCTGTTCCCTGG - Intergenic
915282424 1:154831646-154831668 CTCCTAAGATTTCTGGCACATGG + Intronic
924173677 1:241367442-241367464 CACCCAAGTCTTCTCTTTCAGGG - Intergenic
1065997101 10:31069454-31069476 GACCTCAGGCTTCAGTTACATGG + Intergenic
1066341634 10:34540050-34540072 CTCCTGAGGCTTCTGTTCCAGGG - Intronic
1067248656 10:44569030-44569052 CAATTACGTCTTCTGTTACAAGG + Intergenic
1071127424 10:82351435-82351457 CACCAAAGACTTGAATTACATGG - Intronic
1073568900 10:104559287-104559309 CACCTAATCCTTCAGTGACATGG + Intergenic
1075468584 10:122671055-122671077 CACCTAAGACTTTGGTTTCCAGG + Intergenic
1077657798 11:4038693-4038715 CAGCTGACACTTCTGTTTCAGGG - Intronic
1080580026 11:33634616-33634638 CACCTAAGACTTCTGTTACACGG + Intronic
1082129124 11:48466448-48466470 CACCTATAACTTCTTTTACCTGG + Intergenic
1082248291 11:49950963-49950985 CACCTATAACTTCTTTTACCTGG - Intergenic
1082562659 11:54637403-54637425 CACCTATAACTTCTTTTACCTGG + Intergenic
1083925646 11:65804375-65804397 CACCTACCACCTCTCTTACAGGG - Intergenic
1089871183 11:121673749-121673771 GACCTAAGTCTTCTGTACCATGG - Intergenic
1090591317 11:128273022-128273044 CCCCTTAGACTTCTTTTATAAGG - Intergenic
1097347271 12:58507061-58507083 CACCCATGCCTTCTGTTACTCGG + Intergenic
1101156410 12:101931822-101931844 CACCTAAGACATCTGATTTAAGG + Intronic
1107109635 13:36682720-36682742 AATCTAAGACTTCTCTTATATGG - Intronic
1108834379 13:54522895-54522917 CACCTAAAACTTGTGTTTCTAGG + Intergenic
1110185451 13:72668776-72668798 CACCTACCACTACTGTCACAAGG + Intergenic
1112262798 13:97892907-97892929 AACCAAAGAGTTCTGTTACTAGG - Intergenic
1116021845 14:39470802-39470824 CATTTTAGATTTCTGTTACATGG - Intergenic
1125494299 15:40176456-40176478 CTGTTAACACTTCTGTTACAGGG + Exonic
1127268249 15:57378089-57378111 CACCTGAGACACCTGTCACATGG + Intronic
1128655084 15:69454829-69454851 CAGCCAAGACTTAGGTTACAGGG - Intronic
1129017080 15:72477976-72477998 CAGCTAATTCTTGTGTTACAGGG + Intronic
1130101458 15:80897495-80897517 CACGTAAGCCTTCTTTTTCAGGG - Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1138438349 16:57019543-57019565 GACTTTGGACTTCTGTTACATGG - Intronic
1139177000 16:64700876-64700898 CACCTAAGACCTCTGGTACCAGG + Intergenic
1144034873 17:11356028-11356050 CACCTAAGAATCTTATTACAAGG - Intronic
1149573476 17:57694490-57694512 AAGCTAAGGCTTTTGTTACATGG + Intergenic
1156087596 18:33425481-33425503 CAGCTAAGATTTCTGAAACACGG - Intronic
1158274972 18:55757290-55757312 CCCTGAAGACTTCTGTTAAAAGG - Intergenic
1165153239 19:33772994-33773016 CACCTACGACTTCTACTACATGG + Exonic
1168055754 19:53864277-53864299 CCCCTAAAACCTCTATTACAGGG + Intergenic
1202701369 1_KI270712v1_random:167331-167353 GACCTAAGAATTCTGTTCCCTGG + Intergenic
925437949 2:3857406-3857428 AACCTAAGACATCCGTTTCAGGG - Intergenic
926163883 2:10506067-10506089 CTTCTGGGACTTCTGTTACAAGG - Intergenic
931417902 2:62098883-62098905 CACTTAAGACTTATGATCCAGGG - Intronic
933608167 2:84406162-84406184 CACCTGATCCTTCTGTAACATGG - Intergenic
934172283 2:89550777-89550799 GACCTAAGAATTCTGTTCCTTGG + Intergenic
934282595 2:91625129-91625151 GACCTAAGAATTCTGTTCCTTGG + Intergenic
935221082 2:101013551-101013573 CATCTCAGACTTCTGTTTGAAGG + Intronic
938120294 2:128628364-128628386 CACCTGACACTTCTGCTCCAGGG - Intergenic
938881161 2:135590909-135590931 CACCTAAGGATTATGTTAGAAGG - Intronic
939355892 2:141101286-141101308 CACATAATACTTCCTTTACAAGG + Intronic
940736855 2:157463520-157463542 AAGCTAAGACCTCAGTTACAGGG + Intronic
942720707 2:178949272-178949294 TACCTAATACTTCTGTTGGAAGG - Intronic
942953196 2:181745140-181745162 CCCCAAATACTTGTGTTACATGG + Intergenic
948288527 2:236806739-236806761 CTTCTGAGACTCCTGTTACAAGG - Intergenic
1170233829 20:14079961-14079983 AACCAAAGACTGCTGTTATAGGG + Intronic
1173470080 20:43316674-43316696 CACCTAAAACTCCTGTTGCTGGG - Intergenic
1173755374 20:45511204-45511226 CACCTAGGAATCTTGTTACAAGG + Intergenic
1175086168 20:56460997-56461019 CAGTTAGGACTTCTCTTACAAGG + Intergenic
1175198010 20:57259174-57259196 CACCGAGAACTTCCGTTACACGG + Intronic
1185388265 22:50546467-50546489 GACCTTAGACTTCGGTTGCAGGG - Intergenic
952552507 3:34495325-34495347 CACATAATATTTCTGTTAGAGGG - Intergenic
952774526 3:37031927-37031949 CAACTAAGAAAGCTGTTACAAGG - Intronic
958592233 3:96172673-96172695 CACATAGGATTTCTGTTAAAAGG - Intergenic
960383395 3:116991643-116991665 CAGCTAAGACTCCAGTCACATGG - Intronic
961149698 3:124627492-124627514 TGCCTAAGATTTCTGTTCCATGG - Intronic
964669191 3:159206547-159206569 CAGCTAAGACTCCAGTTTCAAGG - Intronic
965636551 3:170788046-170788068 TCCCTAAGACCTCTGTTGCATGG + Intronic
966159331 3:176951359-176951381 CAGCTGAGACTGCTGATACAGGG - Intergenic
968768789 4:2489863-2489885 CAGCTGAGACTTCTGTTGCTGGG - Intronic
971067119 4:23045636-23045658 CTCCTAAAACTTCTGTGCCATGG - Intergenic
975741708 4:77435594-77435616 CATCTATGTCTCCTGTTACATGG - Intergenic
979327350 4:119395297-119395319 CACCTTAGACTGCAGTTCCAGGG + Intergenic
980247084 4:130260581-130260603 CACCAAAAACATCTGTTACTAGG + Intergenic
980700628 4:136424122-136424144 CACCTAAGGCATCTGGTAGAGGG - Intergenic
981185345 4:141795505-141795527 CACCTTCGACTTCTGCTAAAGGG + Intergenic
981769160 4:148287114-148287136 TAGCTAATAATTCTGTTACATGG - Intronic
982447326 4:155508279-155508301 CCCTTAAGACATCTGTCACAGGG + Intergenic
983245233 4:165279985-165280007 CACCTTAGACTGCAGTTCCAGGG + Intronic
987844825 5:23269726-23269748 CTGCTACGACCTCTGTTACATGG - Intergenic
992893768 5:81229407-81229429 GACTTAAGTCTTCTATTACACGG - Exonic
993106046 5:83602143-83602165 CACCTAAGACTCCTATTAGAGGG - Intergenic
996347606 5:122503697-122503719 CACTTTAAACTTCTTTTACATGG + Intergenic
998091067 5:139369922-139369944 CACCTCAGACTTCAGTGTCAGGG + Intronic
998902561 5:146871542-146871564 CAGCTAAGAATTCTGTTACTGGG + Intronic
1002296793 5:178235866-178235888 ACCCTCAGACTTCTGTGACATGG - Intergenic
1003985616 6:11431726-11431748 GACCTAAGATCTCTGTTCCAAGG - Intergenic
1004801818 6:19157015-19157037 CACTTAACACTTCTGTAACCAGG + Intergenic
1007271898 6:40644121-40644143 CAAATAAGTGTTCTGTTACAAGG - Intergenic
1012025160 6:93980248-93980270 CACCAAAGACATTTGATACAGGG + Intergenic
1013677998 6:112488571-112488593 CACCTAATACTACTGTACCAAGG + Intergenic
1014152539 6:118074760-118074782 CACCTCAGCCTTCTGGTACCTGG + Intronic
1015935997 6:138406442-138406464 AAACTAAGACTTCTGTTTTAAGG - Intronic
1019078062 6:169406942-169406964 CTCCTAAGACTTCTGGTGCTGGG + Intergenic
1020880020 7:13749724-13749746 CACCTAGGACTTCTGGAACCTGG + Intergenic
1030573310 7:111253901-111253923 CACCTAAGAATTCTGATATCTGG - Intronic
1031820153 7:126490601-126490623 CTCCTAAGACCTCTGAAACATGG - Intronic
1035060658 7:156066920-156066942 CTCTTAAGACCTCAGTTACATGG - Intergenic
1037582618 8:20254609-20254631 GACCCAAGACTTCTGCTTCAGGG + Intronic
1041119015 8:54567694-54567716 GACCCAAGAATTTTGTTACATGG - Intergenic
1043119561 8:76305884-76305906 CTCCTTACACTTCTGTCACACGG + Intergenic
1044712635 8:95072420-95072442 CATCTAAGGGCTCTGTTACAAGG - Intronic
1045762476 8:105626923-105626945 CAAATAACACTTCTGTTAAATGG + Intronic
1046648541 8:116811677-116811699 AACCTAAGCCTGCTGTTAGAGGG - Intronic
1049866679 8:144943109-144943131 CAACTAAGAATTCTGTTATCTGG - Intronic
1051895371 9:21981317-21981339 CACCTCACACTTGTGTTACCAGG + Intronic
1059025040 9:110617527-110617549 CACCTGAGGATTCTGTTAAAAGG + Intergenic
1059287521 9:113187877-113187899 CACCTCAGCCATCTGTTACTGGG - Exonic
1186727957 X:12377011-12377033 TTCCTGAGACCTCTGTTACAGGG - Intronic
1187232892 X:17439242-17439264 GTCCCAAGACTTCTGTTCCATGG + Intronic
1190307365 X:49092377-49092399 TACCTAACACTTCTGTTTCTTGG + Intronic
1193473768 X:81939262-81939284 CACCTTAGGCTGCTGTAACAAGG - Intergenic
1193507791 X:82364256-82364278 CTCCCAAAACTTCTGTAACAGGG - Intergenic
1195229917 X:102835958-102835980 CAGTTCAGGCTTCTGTTACAAGG - Intergenic
1195562713 X:106302036-106302058 TATCTGAGACTTCTGTTACTTGG - Intergenic
1196688350 X:118531984-118532006 CTCTTAAGACTTCTTTTAAATGG + Intronic