ID: 1080581940

View in Genome Browser
Species Human (GRCh38)
Location 11:33651491-33651513
Sequence GCCTCCTTCTTCCCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 420}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080581937_1080581940 -9 Left 1080581937 11:33651477-33651499 CCTCAGTCTTTTGTGCCTCCTTC 0: 1
1: 0
2: 1
3: 34
4: 358
Right 1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG 0: 1
1: 0
2: 2
3: 48
4: 420
1080581935_1080581940 -5 Left 1080581935 11:33651473-33651495 CCCTCCTCAGTCTTTTGTGCCTC 0: 1
1: 0
2: 2
3: 55
4: 428
Right 1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG 0: 1
1: 0
2: 2
3: 48
4: 420
1080581936_1080581940 -6 Left 1080581936 11:33651474-33651496 CCTCCTCAGTCTTTTGTGCCTCC 0: 1
1: 1
2: 2
3: 17
4: 311
Right 1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG 0: 1
1: 0
2: 2
3: 48
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080581940 Original CRISPR GCCTCCTTCTTCCCTGGGAC AGG Intronic
900290715 1:1922496-1922518 GCCACCTCCTCCCCTGGGACTGG + Intronic
900370723 1:2331040-2331062 GCCGCCTGCTGCCCTGGGAGGGG - Intronic
900498090 1:2985501-2985523 GCCTCTTTCTTCCCTAGCTCCGG - Intergenic
900621577 1:3590067-3590089 GCCTCCCCCTCCCCTGGGCCAGG + Intronic
901177152 1:7312445-7312467 TCCTCCTTCATCCCTGAGTCTGG - Intronic
901451665 1:9339841-9339863 GCCTGCTCCTTCCGTGGCACAGG + Intronic
901843279 1:11966606-11966628 TCCTCCTTCCTGCCTGGGCCAGG - Intronic
902235987 1:15057781-15057803 CCCTCCTGCTGCCCTGGGGCTGG - Intronic
903243546 1:21999764-21999786 CCCTCCTTCTTCCCTGGCGTAGG + Intergenic
903665898 1:25007258-25007280 GTTTCCTCCTTCCCTAGGACGGG - Intergenic
903728233 1:25468761-25468783 GCCTCCCTCTTCTCTGAGGCAGG - Intronic
904035600 1:27557070-27557092 ACCCCCTTCCTCCCTGGAACAGG + Intronic
904334435 1:29787622-29787644 TCCTCCTCCCTCCCTGGGGCTGG + Intergenic
904670769 1:32163304-32163326 TCCTCTTTCTTACCTGGGTCTGG - Exonic
906142278 1:43540813-43540835 GGCCCCTCCTTCCCTGGGTCAGG + Intronic
906155374 1:43611059-43611081 GCCTCTTTCATCCATGTGACTGG + Intronic
906923172 1:50086717-50086739 GCCTCCTACCACCCTGGGAGTGG + Intronic
909213552 1:72855229-72855251 GTCTCCTCCTACCCTTGGACTGG - Intergenic
910744707 1:90561033-90561055 GCCCCCTGCTTCTCTGAGACAGG + Intergenic
911047336 1:93639368-93639390 GCCTCCTGCCTCCTTGGGTCTGG - Intronic
912580193 1:110714219-110714241 GCCTCCTTCCTCTGTGGCACTGG + Intergenic
913089416 1:115466364-115466386 CCCTCCTTCCTCCCTGGTTCTGG + Intergenic
914224289 1:145707585-145707607 CCCTCCTTGTTCTCTGGGAGTGG - Intronic
915530102 1:156498396-156498418 TCCTGCTTCTTCCCTTGGACTGG + Intronic
916327400 1:163578369-163578391 GTCTCCTTCTGCTCTTGGACTGG + Intergenic
916721802 1:167489943-167489965 GCCAGCTTCCTCCCTGGGCCTGG - Intronic
917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG + Intronic
919513564 1:198494731-198494753 GCCTCCTTGCTGCCTGGGGCAGG + Intergenic
920045471 1:203129543-203129565 CTCTTCCTCTTCCCTGGGACTGG - Intronic
920566803 1:206980616-206980638 TCCTCCTTTTTCCCTGGGACAGG - Intergenic
920826850 1:209430706-209430728 GCCTCTTTCTTCCCTTTGACTGG + Intergenic
922180908 1:223231867-223231889 GCCGGCATCTTCTCTGGGACAGG + Intronic
923160864 1:231313485-231313507 TCCTCTTTCTCCTCTGGGACTGG + Intergenic
923681807 1:236124511-236124533 GCCTCCTGATTAACTGGGACTGG + Intergenic
924685277 1:246283016-246283038 GCCTGCACCTTCCCTGAGACAGG + Intronic
1062956509 10:1543761-1543783 TCCTTCTTCTTCCCTGTGAAGGG + Intronic
1063367215 10:5498785-5498807 GCCTCCTTCTGCCCAAGGTCTGG + Exonic
1063389645 10:5640922-5640944 GCCTCCCTTTCCCCTGGAACCGG + Intronic
1065188607 10:23191962-23191984 GGCTCCTTCCGCCCTGGGACTGG - Intergenic
1066309966 10:34186609-34186631 CCCTCATTCTTCCCTGGGAATGG - Intronic
1069542195 10:69303571-69303593 GCCGCCTACTTCTCTTGGACTGG - Intronic
1070305237 10:75235498-75235520 GCTTCCGGCTTCCCTGGGCCGGG - Intronic
1070362845 10:75707578-75707600 GCCTTCATCTTGCCTGGGCCTGG + Intronic
1070421864 10:76245328-76245350 GCCTACTTATTCCCAGGCACTGG - Intronic
1070706381 10:78642144-78642166 GGCTCCCACTTCCCAGGGACTGG - Intergenic
1070844188 10:79508313-79508335 GACTCTGTCTTCCCAGGGACAGG - Intergenic
1070847319 10:79533941-79533963 CCCTGATTCTTCCCTGGGAGTGG + Intergenic
1070888689 10:79926274-79926296 GCCTTCTTCTCCCCTGGGCATGG - Intergenic
1070926477 10:80226351-80226373 CCCTGATTCTTCCCTGGGAGTGG - Intergenic
1070929610 10:80251999-80252021 GACTCTGTCTTCCCAGGGACAGG + Intergenic
1071790700 10:88951235-88951257 GCCTGCTTATCCCCTGGGGCTGG - Intronic
1072620248 10:97074834-97074856 GCCTCCTCCAGCCCTGGGAGAGG - Intronic
1073554524 10:104435903-104435925 GCCTGCTCCTTCCCTGGCATGGG + Intronic
1074853708 10:117458116-117458138 GGCCCTTTCTTCCCTGGGGCAGG + Intergenic
1075209114 10:120476019-120476041 GTCTCCATGTTCCCTGGGCCTGG - Intronic
1075481935 10:122789626-122789648 GCCTCCTGCTTCCCAGGGATGGG + Intergenic
1075551446 10:123395614-123395636 GGTTCCTTCTTCCCTTGGAGTGG - Intergenic
1075654441 10:124152067-124152089 GCCTCTTTCTTGCCTGGTTCTGG - Intergenic
1075754811 10:124802072-124802094 GGCTCCTTCGCCCCTGGGACAGG + Intronic
1075982141 10:126749282-126749304 GCCTTGTTCTTCCATGGGGCAGG - Intergenic
1076231172 10:128821158-128821180 GCCTCCTGCAGCCCTGGGATGGG - Intergenic
1076476548 10:130757716-130757738 GCCTCCTTCTTCCCAGTTTCAGG + Intergenic
1077028505 11:452402-452424 TGCTCCTGCTTCCCTGGTACTGG - Intronic
1077416385 11:2426163-2426185 ACCTCCTTCCTCCCGAGGACGGG + Intergenic
1077571243 11:3340085-3340107 GACTCTGTCTTCCCTGGGACAGG - Intronic
1078010547 11:7570029-7570051 GGGTCCTTCTTGCCTGGGCCAGG - Intronic
1078067543 11:8088270-8088292 GCTTCCTTCTACCCTCTGACTGG + Intronic
1078705229 11:13737387-13737409 GCATTCTTCTTCCAGGGGACTGG + Intergenic
1078744160 11:14095605-14095627 GCCTTCTCCTGCCCTGGGGCTGG - Intronic
1079089518 11:17470897-17470919 GCCTCAGTCTTCCCTGGGCCTGG + Intronic
1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG + Intronic
1080616080 11:33946051-33946073 GCCACATTTTTCCCTGGGCCTGG + Intergenic
1081566864 11:44265645-44265667 CCCTCCATCTTCCCTGCTACTGG - Intronic
1081656921 11:44863447-44863469 GTCCTCTTCTTCCCTGGGAAGGG + Intronic
1082792058 11:57352890-57352912 GCCTCCTTCTTCTCTGGCCTGGG - Intronic
1083594806 11:63914117-63914139 ACCTCCTTTTTCCCAGGGCCTGG + Exonic
1084155117 11:67308962-67308984 AGTTCCTTCTTCCCTGAGACAGG - Intronic
1084496044 11:69504316-69504338 GCCTCATCCCTCCCTGGGACAGG + Intergenic
1084749918 11:71197911-71197933 GACTCCTTCTTCCCTGGCTGGGG - Intronic
1084879568 11:72160651-72160673 GGCTCCATCTTCCATGAGACAGG + Intergenic
1084938054 11:72597653-72597675 GCCTCGTTCCTCCCTGAGTCGGG - Intronic
1085113929 11:73913184-73913206 GCCTTCTTTTTCCCTTGGTCTGG + Intronic
1085201739 11:74706142-74706164 GCAACCTTCTTCCCAGGGAATGG - Intronic
1085309201 11:75506297-75506319 TCCTTCTTCCTCCCTGGGGCTGG - Intronic
1086920031 11:92575734-92575756 CCCTCCCTCTTCCCTGAGAGGGG + Intronic
1087013751 11:93537141-93537163 GCCTCCCTCTGCCGTGGGAAAGG - Intronic
1088215546 11:107504436-107504458 TCCTCCTACTTCCCTAGGAGAGG - Exonic
1089190349 11:116648989-116649011 GCCCTCTTCTTCCCTGGGCTTGG - Intergenic
1090387268 11:126364406-126364428 GCCTCCTGCTTCCTGGGGAGGGG + Intronic
1090389832 11:126381604-126381626 GCCTCCTGCTTCCTGGGGAGGGG + Intronic
1090393955 11:126406953-126406975 GGCTCCTTCTTCTCTGGGATGGG - Exonic
1091309266 11:134561151-134561173 GCATCCTGCTTCCCTTGGGCAGG + Intergenic
1091954521 12:4627266-4627288 CCCTTCTTCCTCCCTGGGCCAGG + Exonic
1092484492 12:8890718-8890740 GCCTCCACCTTTCCTGGGGCTGG - Intergenic
1092701849 12:11240650-11240672 GCCTTTTTCTTCCCTAGGTCAGG - Intergenic
1093427540 12:19045405-19045427 GCCTCCCTACTCCCTGAGACAGG + Intergenic
1095245613 12:39917636-39917658 ATCTCCTCCTGCCCTGGGACTGG + Intronic
1095629296 12:44355830-44355852 TCCTGCTTCTTCACTGGGTCAGG - Intronic
1096085822 12:48864563-48864585 GCCACTCTCTTCCCTGGGTCTGG - Intronic
1096523033 12:52194772-52194794 GCCTCCTGCTTCCCTGGGTGGGG - Intergenic
1096994764 12:55831589-55831611 CCCTCTTTCTGCCCTGGGCCTGG + Intergenic
1098820387 12:75220576-75220598 GCCTCCTTCTTACCTGAAGCTGG + Intergenic
1099686264 12:85893128-85893150 CCCTCCTTCTTCCCTGAGGGAGG - Intergenic
1101892931 12:108731965-108731987 GCCTCCTGCTTCCCTAAGCCCGG + Intergenic
1102111767 12:110370706-110370728 CCCTCCTGCTGCCCTGGGGCAGG + Intergenic
1102119336 12:110428795-110428817 GGCCCCACCTTCCCTGGGACTGG + Intergenic
1102924972 12:116819537-116819559 GCCTCCTCCTCCCCCGGGCCCGG - Intronic
1102996890 12:117358357-117358379 GCCTCCATCTTCCTTGGGGAAGG - Intronic
1103407649 12:120687146-120687168 GCCTCCTTCTTCTCAGCCACGGG - Exonic
1104719695 12:131038492-131038514 GCATCTTTCTTCTCTGTGACTGG + Intronic
1108312727 13:49211792-49211814 ACCTGGTTCTTTCCTGGGACAGG - Intergenic
1108321924 13:49298175-49298197 GCCTCCCTGTTCCCTGGGGATGG + Intergenic
1109525293 13:63566888-63566910 ACCTCCTTCTTCTCGGGCACGGG + Intergenic
1109982329 13:69924604-69924626 ACCTCCTTCTTCCTGGGCACGGG + Intronic
1112771516 13:102799406-102799428 GCCTCCTGTTACCCTGGGGCCGG - Exonic
1113595818 13:111531006-111531028 GCTTCCCTCTGCCCAGGGACTGG + Intergenic
1113639107 13:111944481-111944503 GCCACCTCCTCCCCAGGGACAGG - Intergenic
1113892684 13:113744528-113744550 TCCTCCTGCTTGCCTGGGAGTGG + Intergenic
1113955611 13:114098694-114098716 GGTTCCTTCTTCCCTGGGTCTGG - Intronic
1114525010 14:23362372-23362394 GCATCCTTCTCCCCAGGGTCTGG - Intronic
1117817294 14:59611296-59611318 GCCTCCTAGTTCTCTTGGACTGG + Intronic
1117878801 14:60285684-60285706 GCCTCCTTCTTCACTGCTTCTGG - Exonic
1118597024 14:67443645-67443667 GCCTCCTGAGTACCTGGGACTGG - Intergenic
1118722905 14:68607216-68607238 GCCTCAGCCTTCCCTGGAACTGG - Intronic
1118770425 14:68939135-68939157 AGCTCCTTCTTGCCTGGTACAGG + Intronic
1119406465 14:74402505-74402527 CACCCCTTCTTCCCTGGGGCTGG + Intergenic
1119420525 14:74505473-74505495 GCTGCCTGCCTCCCTGGGACGGG + Intronic
1119421332 14:74509512-74509534 GCTTCCCTCTTCTCTGGGACTGG + Intronic
1120226593 14:81797433-81797455 TCCAGCTTCTTCCCTGGAACAGG - Intergenic
1121430052 14:93880146-93880168 GCCTCCGCCTCCCCTGGGAGAGG + Intergenic
1121626299 14:95387816-95387838 GCCTCCTTCTAGCCTGGGCTGGG + Intergenic
1121757731 14:96417082-96417104 CCCTCCTTGCTCCCTGTGACTGG - Intronic
1122175255 14:99912925-99912947 GGCTGCTTCTTTCCTGGAACGGG + Intronic
1122289824 14:100674587-100674609 CACTCCTTCTCCACTGGGACGGG - Intergenic
1122694042 14:103544293-103544315 GCCTCCTCCTGGCCTGGGCCAGG - Intergenic
1122805553 14:104254766-104254788 GCTTCCTTCTTCCCTAGGTCAGG - Intergenic
1122824286 14:104362166-104362188 GCCTCCTTCTACCCTGGCTGAGG - Intergenic
1124024264 15:25950110-25950132 GACTCCTGCTTTCCTGGGACAGG + Intergenic
1124322318 15:28724281-28724303 GACTCCTGCTTTCCTGGGACAGG - Intronic
1124523409 15:30426086-30426108 GACTCCTGCTTTCCTGGGACAGG - Intergenic
1124535257 15:30540128-30540150 GACTCCTGCTTTCCTGGGACAGG + Intergenic
1124657990 15:31524201-31524223 GCCTCCTGCATCACTGGCACAGG + Intronic
1124763397 15:32467468-32467490 GACTCCTGCTTTCCTGGGACAGG - Intergenic
1124775229 15:32581579-32581601 GACTCCTGCTTTCCTGGGACAGG + Intergenic
1125357300 15:38829929-38829951 CCATCCTTCTTCTCTGGCACTGG + Intergenic
1125545285 15:40498910-40498932 GCCTCCTCCCTGCCTGGCACTGG - Intergenic
1125734096 15:41911697-41911719 GCCTCCTGCTTCCCTTGGGGTGG - Intronic
1127086438 15:55428305-55428327 ACCTCCTTCTTGCCTGGGGACGG - Intronic
1127691499 15:61401926-61401948 GCCTGCTTCTTCCATGGTTCTGG + Intergenic
1127707678 15:61563117-61563139 CCCACCTTCTTCACTGGGAGCGG + Intergenic
1128060369 15:64731815-64731837 GGCCCCTTCTTCCCTGTGATTGG - Intergenic
1128144834 15:65327229-65327251 GCCTCCCTCTCCCTTGGGAAGGG - Exonic
1128940574 15:71784709-71784731 GCCTCCATCTCCCCGGGGCCTGG + Intergenic
1129032566 15:72629464-72629486 GACAGCTTCTTCCCTGGGCCAGG - Intergenic
1129217326 15:74107779-74107801 ACCAGCTTCTTCCCTGGGCCAGG + Intronic
1129236359 15:74225950-74225972 TTCTCCATCTTCCCTGGGACGGG - Intergenic
1129697085 15:77746882-77746904 GCACCCTCCTTCCCTGGGAGTGG - Intronic
1129700937 15:77768402-77768424 GCCTCCTGCGTCCCAGGCACTGG + Intronic
1129734482 15:77952063-77952085 ACCCGCTTCTTCCCTGGGCCAGG + Intergenic
1129841108 15:78743928-78743950 ACCCGCTTCTTCCCTGGGCCAGG - Intergenic
1130416707 15:83701304-83701326 TCCTCAGTCTTCCCTTGGACAGG + Intronic
1130997800 15:88913380-88913402 GGCGCCTTCTCCTCTGGGACCGG + Exonic
1132609647 16:808935-808957 TCCTCCTCCTGCCCTTGGACAGG - Intronic
1133218909 16:4309962-4309984 CCCTCCTTTCTCCCTGGGGCAGG + Intergenic
1134165777 16:11928145-11928167 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134494945 16:14725595-14725617 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134500328 16:14764715-14764737 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134526870 16:14951327-14951349 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134545535 16:15105021-15105043 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134580251 16:15364335-15364357 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134682146 16:16133772-16133794 GGCTCCTTCTTCCCTCCTACAGG - Intronic
1134714447 16:16349804-16349826 GACTCTGTCTTCCCTGGGGCAGG + Intergenic
1134722322 16:16393168-16393190 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134945105 16:18318701-18318723 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134952369 16:18358854-18358876 GACTCTGTCTTCCCTGGGGCAGG - Intergenic
1135311170 16:21405559-21405581 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1135364122 16:21838010-21838032 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1135447720 16:22533338-22533360 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1136150324 16:28343454-28343476 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136166561 16:28457292-28457314 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136196414 16:28657740-28657762 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1136212754 16:28771865-28771887 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1136257476 16:29051784-29051806 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1136307874 16:29384555-29384577 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136321290 16:29486099-29486121 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136363874 16:29799505-29799527 AGCCCCTTCTTCCCTGAGACAGG - Intronic
1136435970 16:30226069-30226091 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136500439 16:30667416-30667438 GCCTCCCTCTTCACTGCGACTGG + Exonic
1136515889 16:30768178-30768200 CCCTCCTCTTTCCCTGGGGCTGG - Exonic
1137708236 16:50549344-50549366 GCCTCCTTCTTCCCTCCGCGGGG + Intronic
1138278202 16:55751490-55751512 GCCTCATTATTCCCTGCGATGGG + Intergenic
1138290474 16:55842455-55842477 GCCTCATTATTCCCAAGGACGGG - Intergenic
1138364803 16:56466209-56466231 ACCTGGTTCCTCCCTGGGACAGG + Exonic
1138509459 16:57499797-57499819 GTCTTCCTCTTCCCTGGGCCTGG - Intergenic
1138688164 16:58744724-58744746 GCTTCCTTCTTCCCCTGAACCGG + Intergenic
1139855563 16:69976998-69977020 GACTCTGTCTTCCCTGGGGCAGG - Intergenic
1140367170 16:74391103-74391125 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1140524491 16:75611466-75611488 GCCTCAATCTTCCCAGGGTCAGG + Intronic
1141084126 16:81079264-81079286 TCCTCTTTCTTCCCTGCAACAGG - Intergenic
1141253973 16:82383831-82383853 GCCTGCTTCATCACTGTGACTGG + Intergenic
1141567589 16:84913654-84913676 GCCTCCTCCTCCCCTGGCTCAGG + Intronic
1141743714 16:85911877-85911899 CCCTCCTTCATCCCTAGGGCTGG + Intronic
1141785878 16:86200565-86200587 TCCTCCTTCATCCCTGGAAGTGG + Intergenic
1142251848 16:88995582-88995604 GCCCTCTTCTTCCCAGGGGCTGG - Intergenic
1142715658 17:1745581-1745603 CGCTCCCTCTTCCCTGGGGCTGG + Intronic
1143036768 17:4004033-4004055 GCCTGCTGCCTTCCTGGGACTGG - Intergenic
1143120603 17:4604243-4604265 GCACCCTTTCTCCCTGGGACAGG - Intronic
1143130094 17:4672505-4672527 GGCTCCTCCTTCGCTGGCACAGG + Exonic
1146913475 17:36663135-36663157 GCACCCTCCGTCCCTGGGACTGG - Intergenic
1147121886 17:38339949-38339971 GCATCCTTCCTCCCAGGTACAGG - Intronic
1147313203 17:39606874-39606896 GCCTGCTTCTTCTCAGGGTCAGG + Intronic
1148087997 17:45006294-45006316 GCTTCCTTCGTTCCTGGGAGGGG + Intergenic
1150166927 17:62952770-62952792 AACTCCTTCTTCCCGGTGACTGG - Intergenic
1151345967 17:73501387-73501409 GCCTGCCTCTCCCCTGGAACAGG - Intronic
1151556263 17:74848189-74848211 GCCCCCCACTTCCCTGGGACAGG + Intronic
1151952039 17:77360206-77360228 GCCACCTTCTTCCCTGAGCATGG + Intronic
1151952068 17:77360348-77360370 GGCTTATTCTTCCCTGGGAAGGG - Intronic
1152555856 17:81052803-81052825 GCCTCCTGCTTGTCTGCGACAGG + Intronic
1152906839 17:82974938-82974960 GACTCCATCCTCCCAGGGACCGG + Intronic
1153162001 18:2216907-2216929 CCCACCTTCTGCCCTGTGACAGG - Intergenic
1153692328 18:7606224-7606246 CATTCCTTGTTCCCTGGGACTGG + Intronic
1154117036 18:11620186-11620208 GACTCTGTCTTCCCTGGGGCAGG - Intergenic
1156409598 18:36815159-36815181 TCCTCCTGCTTCTCTGGTACAGG + Intronic
1157571131 18:48713130-48713152 GCCTCCTTCTTCCCTCTACCAGG - Intronic
1157972997 18:52292647-52292669 CCCTCATTCTTCCCTGGAATGGG + Intergenic
1160776619 19:859538-859560 GCCTCCGCCCTCCCCGGGACTGG - Intergenic
1160801715 19:973499-973521 GCCACATTCATCCCTGAGACAGG - Exonic
1160943738 19:1631734-1631756 TCCTCCTGCTTCCCGGGGAGGGG - Intronic
1161043640 19:2123110-2123132 CCCTGCATCTCCCCTGGGACTGG + Intronic
1161161114 19:2762302-2762324 GCCTCCTGCTTCCAGGGGTCTGG + Intronic
1161456702 19:4373231-4373253 CCCTCCATCTTCCCTTGGGCTGG - Intronic
1162305647 19:9871758-9871780 GCCTGCCTCTACCCTGGGAAAGG + Intronic
1163633099 19:18426932-18426954 CCCTCCTTCCTTCCTGGGCCGGG + Intronic
1164574281 19:29396624-29396646 TCCTCCTCCTCCCCAGGGACAGG + Intergenic
1165146621 19:33735015-33735037 GCCTCCTTCTTGCCTGGGCTGGG - Intronic
1166055071 19:40283764-40283786 GCAGCCTTCCTCCCTGGGCCAGG + Intronic
1167533266 19:50032169-50032191 ACCTCCTTCATCACTGTGACAGG + Intronic
1167698672 19:51029648-51029670 CCACCCTTCTTCCCTGGGATTGG - Intronic
1167773807 19:51541755-51541777 GCCTCCTTCTGCTCTCAGACTGG + Intergenic
1167779666 19:51590866-51590888 GCCACCTTCCTCCCTGAAACTGG - Exonic
1168555719 19:57338320-57338342 GCCTCCTTCTGCCTTGCTACTGG + Intergenic
925681275 2:6424211-6424233 ACCTCCTTTTTCTCTGGGCCTGG - Intergenic
926588566 2:14715978-14716000 GCCACCTTCTTACCTGGAAAAGG + Intergenic
927553716 2:24018516-24018538 GGCCCCACCTTCCCTGGGACTGG - Intronic
928207308 2:29295194-29295216 GCCTCCTTCTTCCCTGTTAAAGG - Intronic
929434984 2:41921898-41921920 GCCTCCTTCTCACCTGGAAACGG - Intergenic
930702757 2:54475570-54475592 GCCTCCTGCTACCATGTGACAGG + Intronic
931035900 2:58242500-58242522 CCATCCTTCTTCCCTGAGGCGGG + Intergenic
931726449 2:65116033-65116055 GCCTCCTTAGTAGCTGGGACTGG - Intronic
932306065 2:70705063-70705085 GCTTCCTTCTTCCCTTTTACAGG - Intronic
932469711 2:71945830-71945852 GCCACCTTCTGCCCTGAGCCTGG - Intergenic
933667182 2:84972338-84972360 GTCTCTTTGTGCCCTGGGACTGG - Intronic
934517023 2:94994638-94994660 GCCTCCGTGTTCCCGGGGAGAGG - Intergenic
934616594 2:95775079-95775101 GCCTCCTTCCTCTCTGGGAAAGG + Intergenic
934644298 2:96049480-96049502 GCCTCCTTCCTCTCTGGGAAAGG - Intergenic
934837713 2:97605570-97605592 GCCTCCTTCCTCTCTGGGAAAGG - Intergenic
935552093 2:104468458-104468480 ACCCCATGCTTCCCTGGGACAGG - Intergenic
936977936 2:118237827-118237849 GCCTCCTTCTCCCTTTGTACTGG - Intergenic
937267013 2:120623106-120623128 GCCCCCCTCTTCCCAGGGAAAGG - Intergenic
937917282 2:127105494-127105516 TCCTCCTCCTTCCCTGGGGTGGG + Intronic
938096386 2:128466918-128466940 GCCTCCTTCTTCCTGGACACAGG - Intergenic
939488669 2:142849986-142850008 TCCTCCTCCTTCCCTGTGTCAGG + Intergenic
939630469 2:144522434-144522456 GGCTCCTTCTTCCTTAGGAGTGG - Intronic
939949741 2:148455718-148455740 GGCTCCAACTTCCCTGAGACTGG - Intronic
940550190 2:155144298-155144320 GACTCCCTCTTCCCTAGGGCAGG - Intergenic
940857408 2:158740226-158740248 GCCTGCATCATCCCTGGGTCAGG - Intergenic
941395831 2:164971629-164971651 TCCTCTTTCTTCCCAGAGACTGG + Intergenic
942152098 2:173086857-173086879 TCCTCCTTCTTCCCTGACCCTGG + Intronic
942247826 2:174023916-174023938 GCCTCTGGCTTCCCTGGGGCTGG + Intergenic
943426945 2:187749550-187749572 ACCTCATTCTTCCCAGGCACAGG - Intergenic
943758517 2:191584282-191584304 GCCACCTACTTCTCTTGGACTGG + Intergenic
943816370 2:192262385-192262407 GCCTTCTTCTGCCCTTGAACTGG - Intergenic
944243032 2:197504170-197504192 TCCACCTTCTTCCCAGGCACAGG + Intronic
946143123 2:217708664-217708686 GCCTCCTTTTTCCCTGGGGTGGG - Intronic
946346989 2:219118733-219118755 GCCTCCCCCTTCCCTGGGGCGGG - Intronic
946907648 2:224431644-224431666 GCCTCCATCTCCCCTGGCTCAGG - Intergenic
947907748 2:233777958-233777980 CACTCCTCCTTCCCGGGGACTGG - Intronic
948801110 2:240434087-240434109 TGCTCCTTCTTGCCTGGGCCTGG - Intergenic
1170613043 20:17929584-17929606 GCTTCCTGCTCCCCTGGCACTGG + Intergenic
1171177265 20:23061771-23061793 GACTGCTTCCTCCTTGGGACTGG + Intergenic
1172148731 20:32775729-32775751 GCTCCCTTCATCCCTGGGATGGG + Intronic
1172884113 20:38219928-38219950 GCCTTGGTCTTCCATGGGACTGG + Intronic
1172935782 20:38619146-38619168 ACCTCCTTCTTCCCTCTGCCTGG - Intronic
1173126174 20:40338045-40338067 GCCTCCCTGTTCCTTGGGATTGG - Intergenic
1173823385 20:46032286-46032308 GCCTCCTCCTTCGCGGGGGCGGG - Intronic
1173823942 20:46035466-46035488 GCTCCCTACTTCCCTGGGGCAGG - Exonic
1174080006 20:47963895-47963917 TCCTCCTTCTTCCCTGTCTCTGG + Intergenic
1174112500 20:48206049-48206071 GCTTCATCCTTCCCTGGGGCTGG - Intergenic
1174381137 20:50156044-50156066 CCCTGCTGTTTCCCTGGGACAGG - Intergenic
1174841025 20:53901713-53901735 GCCTCCTTCTTCCTTTAGAGGGG - Intergenic
1175456703 20:59120803-59120825 GCCTGCTTCTTTCCTGAGGCTGG - Intergenic
1175686432 20:61031648-61031670 GCCTCCTTCTCCCTTGGGGGTGG - Intergenic
1176112297 20:63416150-63416172 GCCTCCCCCTGCCCTGGGGCAGG - Intronic
1176364617 21:6025391-6025413 GCCTCCCACTGCCCTTGGACAGG + Intergenic
1177262653 21:18750410-18750432 GCCTCATTCTTCCTAGGCACAGG + Intergenic
1178289887 21:31358125-31358147 GCCGCCCTCTGCCCTGAGACAGG - Intronic
1179556630 21:42182774-42182796 GCCTCCTTCTCCCTAGGGGCTGG + Intergenic
1179626183 21:42650817-42650839 GCCTTCTCCTGCCCTGGGACTGG + Intergenic
1179758901 21:43513154-43513176 GCCTCCCACTGCCCTTGGACAGG - Intergenic
1181437401 22:22918716-22918738 CCCTCCTCCTCCCCCGGGACAGG + Intergenic
1181725068 22:24806002-24806024 CCCTCCCTCTTCCCTAGGGCGGG - Intergenic
1182428274 22:30286201-30286223 ACCTCCTCCCTGCCTGGGACTGG + Intronic
1182603943 22:31489401-31489423 GCCTCCCTCCTCCCTGCGGCCGG - Exonic
1182850313 22:33468350-33468372 GCCTCAGTCTTCCAAGGGACTGG - Intronic
1183253264 22:36744800-36744822 TCTTCCTTTTACCCTGGGACAGG + Intergenic
1183687016 22:39367019-39367041 GGCTGCTTCTTCCCTGGGCTCGG + Intronic
1184148731 22:42626565-42626587 GGCTCTTTCTCCCCTGGGCCTGG + Intronic
1184273862 22:43399487-43399509 GGCTCTTTCTTCTCTGGGACTGG + Intergenic
1184699351 22:46159941-46159963 CACACCTTCTTCCCTGGGTCTGG - Intronic
1184968216 22:47996692-47996714 GCCTCCTTCACCTCTGGGGCTGG - Intergenic
1185032283 22:48450399-48450421 GACTCCTTTTTCCCTGGGGCTGG + Intergenic
1185214880 22:49593050-49593072 GCCTTCTCCTGCCCTCGGACTGG + Intronic
1185366354 22:50438714-50438736 GCTTCCTTCTTCCCGGGGGCCGG - Exonic
950211200 3:11124837-11124859 GCCTCTTTCTCCCAGGGGACAGG - Intergenic
950355239 3:12402822-12402844 CCCTCCTTATTCCCTGGGATTGG + Intronic
950500159 3:13358632-13358654 GTCTACCTCTTCCCTGGGATAGG - Intronic
950809845 3:15640995-15641017 TCCACCTTCCTCCCTGGGGCTGG + Intronic
953025413 3:39142232-39142254 CCCTCCTACATCCCTGGGCCTGG + Exonic
953119084 3:40022204-40022226 GCCACCTTCGTCCCTAGTACAGG - Intronic
953605271 3:44409692-44409714 GCCTGTTTCTCCCTTGGGACAGG - Intergenic
953879061 3:46682175-46682197 CCCTTCCTCTTCCCTTGGACTGG + Intronic
954919907 3:54181045-54181067 GCTTCCCTCTTCTCTGTGACTGG + Intronic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
956280374 3:67550107-67550129 GCCGTATTCTTCCCTGGGCCTGG + Intronic
958080322 3:88738163-88738185 GTCTCCTTCTGCCCAGGAACAGG + Intergenic
958968698 3:100587229-100587251 GCCTCCTAGTTCTCTTGGACTGG - Intergenic
960046137 3:113200340-113200362 GCCTCTCTCCTCCCTGGGACAGG + Intergenic
961490530 3:127254046-127254068 GCCTCCTGCTTCCAGGTGACTGG - Intergenic
961650681 3:128415349-128415371 ACCACCCTCTTCCCTGGGCCTGG - Intergenic
962752037 3:138440645-138440667 GCCTCTTCCTTCCCGAGGACAGG - Intronic
963336791 3:143984508-143984530 GCCTCCCTGTTCCCTGGGGATGG + Intronic
964870023 3:161303393-161303415 TCCTCCTTCTTACCTGGCCCTGG + Intergenic
964878858 3:161400983-161401005 ACCTCCTTTTTCCCTAGGAGGGG + Intergenic
966982557 3:185152343-185152365 GATTCCCGCTTCCCTGGGACAGG + Intronic
969611990 4:8232588-8232610 GTCACCTGCTTCCCTGGGGCAGG + Intronic
969657498 4:8506692-8506714 GCCTCCTTCCGCCCAGGGGCTGG - Intergenic
969676522 4:8617379-8617401 GCATCCTCCTTCCCTGGCCCCGG - Intronic
970795628 4:19909237-19909259 GTCTTCTCCTTCCCTTGGACTGG + Intergenic
970824323 4:20253782-20253804 GCCTCCTTCCTCGCCGGCACTGG - Exonic
974808955 4:66920912-66920934 CCCTCCTTCCTCCATGGGACAGG + Intergenic
977673465 4:99722295-99722317 TCCTCTTCCTTCCCTGAGACAGG - Intergenic
981183188 4:141769748-141769770 GTCTTCATATTCCCTGGGACTGG + Intergenic
982170248 4:152655234-152655256 GCATCCTTCTTGGCTGAGACTGG + Intronic
983506220 4:168556525-168556547 GCATCCTGCTTCGCTGGTACAGG - Intronic
983877479 4:172893636-172893658 GGCTATTTCTTCCGTGGGACGGG - Intronic
984701046 4:182819087-182819109 GCCTCCCTTCTCCCTGGCACTGG - Intergenic
986029487 5:3881557-3881579 TCCTTCTCCTTCCCTGGGATGGG + Intergenic
987083368 5:14446259-14446281 GCCGCCTTCTCCCCAGGCACTGG + Intronic
987377296 5:17247892-17247914 GCCTCCCTCTTTCCTGGAAAAGG + Intronic
987382624 5:17299913-17299935 GTTTCCTTCTTACCTGGGAATGG + Intergenic
988585147 5:32501335-32501357 CCCACTTTCTTCCCTGGGTCGGG + Intergenic
989170392 5:38467031-38467053 CCATCCTTCCTCCCTAGGACAGG - Intergenic
989332745 5:40278820-40278842 GCCTCCTTCCTCCCTCAGCCTGG - Intergenic
990169821 5:53035641-53035663 TCTTCCTTCTTCCCAGAGACGGG + Intronic
991359220 5:65802626-65802648 ACCTCCTTCTTCCTGGGCACGGG - Intronic
992052704 5:72955982-72956004 GCCGCCTTCTTCCCAGAGACCGG - Exonic
992107366 5:73461011-73461033 TCCTCCTTCTTACCTGGGACTGG + Intergenic
992267826 5:75035305-75035327 TCCCCTTTCTTCCCTGGGAAAGG - Intergenic
992358105 5:76006616-76006638 GCCTGCTTTCTCCCTGGGATTGG + Intergenic
993115928 5:83720977-83720999 GCCTCCTTCTTCCCAGGATCAGG - Exonic
994961058 5:106603371-106603393 GCCTCCCTATTGCCTGAGACAGG + Intergenic
995243627 5:109913030-109913052 GCCCCCTTCTGCTTTGGGACAGG + Intergenic
996399514 5:123046381-123046403 GCCACATTCCTCCCTGGGCCTGG - Intergenic
997425094 5:133797724-133797746 ACCTCCTCCTTCCCCAGGACTGG + Intergenic
997591640 5:135076806-135076828 GCCTCCTACTTGCCAGGGACTGG - Intronic
998516111 5:142755708-142755730 GCCTCCTTTGTCCCAGGTACTGG + Intergenic
999260756 5:150237439-150237461 ACCTCCTCCTTCCCCAGGACAGG - Intronic
1000098851 5:157995152-157995174 GCCTCCTTCTTCCATTTGGCTGG + Intergenic
1001159015 5:169298136-169298158 GTCTCCTTCCTCCCTGGGAATGG - Intronic
1001231644 5:169993891-169993913 ACCTTCTTGTTCCCTGGGAGGGG + Intronic
1001235274 5:170024026-170024048 GCCTCCCTCTTCCAGGAGACTGG - Intronic
1001313054 5:170624836-170624858 TCCTCCTCCTGCCCTGGGCCAGG - Intronic
1001559245 5:172658722-172658744 GCCGCCCTCCTCCCTGGGAGGGG + Intronic
1001951304 5:175818396-175818418 GCTTCCTCCTAGCCTGGGACAGG - Intronic
1002504201 5:179667602-179667624 TCCTCCTTCGTCCCTGTGGCTGG + Intergenic
1002569680 5:180133091-180133113 GCCTCCTTCAGCCTTGGCACTGG + Intronic
1003109061 6:3238407-3238429 GAGTCCTTCTGCGCTGGGACAGG - Intronic
1003245388 6:4378265-4378287 CCCTCCATCTTCCCTGGCTCTGG - Intergenic
1003571215 6:7257871-7257893 CTCTCCTGCCTCCCTGGGACGGG - Intergenic
1003624796 6:7730921-7730943 ACATCCGACTTCCCTGGGACTGG + Intronic
1005826272 6:29633130-29633152 CCCTCCTTCTTCCCTCCGCCCGG - Exonic
1006162352 6:32046039-32046061 TCCTCCTCCTTCCTGGGGACAGG + Exonic
1006472462 6:34236565-34236587 GTATCCTTCCTCCCTGGTACAGG - Intergenic
1006474590 6:34246028-34246050 GGCCCCACCTTCCCTGGGACTGG - Exonic
1009283722 6:61785065-61785087 GCCTCCATCTTCCCAGGCTCAGG - Intronic
1010993549 6:82506804-82506826 CTCATCTTCTTCCCTGGGACTGG + Intergenic
1011743648 6:90387997-90388019 CCCTCCTCCTTCCCAGGGAGTGG + Intergenic
1012306620 6:97666660-97666682 TCCTCCTTCTTCCCTGGTCATGG + Intergenic
1013804876 6:113986024-113986046 CCCTCCTTCTTCTCTGCCACTGG - Intronic
1014798329 6:125749680-125749702 GCCTCCTCCCTCCCCGGGCCTGG - Exonic
1015049253 6:128818988-128819010 GCCTCCCTCTTCCCCAGGTCTGG + Intergenic
1015162188 6:130165963-130165985 ACCTCCTTCATCCCAGGGTCAGG + Intronic
1015379562 6:132551292-132551314 TGTTCCTTCTTCCCTGGGAGGGG + Intergenic
1015519132 6:134114156-134114178 GGCCCTATCTTCCCTGGGACTGG + Intergenic
1016539979 6:145153682-145153704 GGCTCCTCCTTTCCTGCGACTGG - Intergenic
1018239890 6:161763366-161763388 GTCTCCTGTTTCCCAGGGACAGG - Intronic
1018719020 6:166558316-166558338 GCGTCCCTCTTCCTTGGGACAGG + Intronic
1019168865 6:170117421-170117443 GCCTCCTGCCTCCCTCGGTCTGG + Intergenic
1019335564 7:480985-481007 TCCTCCATCTCCCCTGGGCCTGG - Intergenic
1019562660 7:1666161-1666183 GGCCCCTTCTTACCTGGGCCGGG - Intergenic
1019661252 7:2225236-2225258 GCCCCCTTGCTCCCAGGGACTGG + Intronic
1019756533 7:2774851-2774873 GCCACCTTCTTACCTGGGGTTGG + Intronic
1020326666 7:6979582-6979604 GTGCTCTTCTTCCCTGGGACGGG + Intergenic
1022112757 7:27241438-27241460 ACCAGCTTCTTCCCTGGGAGAGG + Intergenic
1022391211 7:29946358-29946380 GCCTCCTTCCTCCCTTCCACAGG + Intronic
1023370695 7:39509558-39509580 TCCTCGTTCCTCCCTGGGACTGG + Intergenic
1023643487 7:42284733-42284755 GTCACCTTCTTTCCTGGGAGGGG - Intergenic
1024366460 7:48526198-48526220 CCCTCCTTCTCCCCTGAGGCTGG - Intronic
1025012021 7:55405196-55405218 GTCTCCTCCTGCCCTTGGACTGG - Intronic
1025990307 7:66492401-66492423 GCTTCCCTCTTCCTGGGGACAGG - Intergenic
1031618834 7:123911727-123911749 GACTGCTAGTTCCCTGGGACTGG - Intergenic
1032431682 7:131867379-131867401 GGGTCCTTCCTCCATGGGACTGG + Intergenic
1034898444 7:154892547-154892569 CCCTCCCTCTTCCCTCGGAGGGG + Exonic
1036453100 8:8885822-8885844 GCCTCATTCTTCCCAGGAGCTGG + Intronic
1036771377 8:11580540-11580562 GCCTCCTCCTTCTATGGGCCTGG - Intergenic
1036780229 8:11641741-11641763 CTCTTCTTCTTCCCTGGGCCTGG + Intergenic
1037164130 8:15806379-15806401 GCCTCCTTCTTCGCTGCTTCTGG + Intergenic
1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG + Intergenic
1038963025 8:32542707-32542729 GCCTCCTTCTTCAAGGGCACTGG + Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039870288 8:41540194-41540216 GCTTCCTTGTTCCCTGGGGTGGG + Intronic
1042084974 8:65097506-65097528 TCCTCCTTCTACCCTGTCACGGG - Intergenic
1042405672 8:68402977-68402999 GCCTGCTGCTTCCCAGTGACTGG - Intronic
1044412692 8:91901963-91901985 GCTCCCTTGTTTCCTGGGACAGG + Intergenic
1044447841 8:92299220-92299242 CCCTCCTAGTTCCCTGGAACAGG - Intergenic
1048986589 8:139738155-139738177 GGCTGCTGCTTCCCTGGGATAGG - Intronic
1049908950 9:246507-246529 GCCTCCTTTTTTCCTGAGACAGG - Intronic
1050605450 9:7296608-7296630 ACCCCTTACTTCCCTGGGACAGG - Intergenic
1052102472 9:24465789-24465811 GCCTACTTCTTCCTTGAGAGAGG + Intergenic
1052182128 9:25542628-25542650 GCCTCCTGATTAGCTGGGACAGG - Intergenic
1052374380 9:27701369-27701391 GCCTCCTTCTTCTCTTGGAGGGG + Intergenic
1052708003 9:32016313-32016335 ACCTCATTCTTCCCAGGCACAGG - Intergenic
1053131718 9:35619173-35619195 GCCCCCTTTTTCCTTGGGGCTGG - Intronic
1053428782 9:38028163-38028185 GCCTGCTTAGTCTCTGGGACAGG - Intronic
1053593461 9:39534940-39534962 GCCACATTCATCCCTGAGACAGG + Intergenic
1053851195 9:42289648-42289670 GCCACATTCATCCCTGAGACAGG + Intergenic
1054572845 9:66830337-66830359 GCCACATTCATCCCTGAGACAGG - Intergenic
1055931327 9:81562567-81562589 GCCTCCTCTGTCCCTGGGAGTGG + Intergenic
1056659369 9:88533754-88533776 GCCTCCTTCTAGCCCGGGTCTGG + Intergenic
1056948884 9:91026072-91026094 TCCTCCTGCTTCCCTGACACAGG + Intergenic
1057047701 9:91898775-91898797 GTCTCCTTCTGCACTGGGGCTGG - Intronic
1057488052 9:95501570-95501592 GCCTCCTTCTTCCTTGACGCTGG + Intronic
1058824490 9:108762501-108762523 GCCCCCTGCTTCCCCGGGCCTGG - Intergenic
1059436370 9:114279015-114279037 GGCTGCGTCTCCCCTGGGACAGG - Intronic
1059471195 9:114505625-114505647 ACCCCTTTCTTCCCTGGGGCTGG - Intergenic
1059723767 9:116986347-116986369 GCCTCCATCTCCCCTGTGCCAGG - Intronic
1060177301 9:121506385-121506407 GCCTCCTGCTTGCCTAGGTCTGG - Intergenic
1060204246 9:121673247-121673269 CCCTCCATCTTCTCTGGGGCTGG + Intronic
1060407906 9:123381869-123381891 CCCTCCAGCTTCCCTGGGGCCGG - Exonic
1060520556 9:124291791-124291813 GCCCCCTGCTTACCAGGGACTGG - Intronic
1060821216 9:126662583-126662605 GCCTCCTTCCTCCCGAGGGCAGG - Intronic
1060881828 9:127122879-127122901 GCCCCCTCCTTCCTTGGCACGGG + Exonic
1060938379 9:127528907-127528929 GCCTCCTGCTGGGCTGGGACTGG - Intronic
1061429895 9:130524193-130524215 GCCTCCTTCTCCCCTGAGGCAGG - Intergenic
1061724750 9:132575959-132575981 GCCTCCCTCTTACCTTGGAGGGG - Intergenic
1061957992 9:133973532-133973554 GTCTCCTTCCTCTCTGGGAGTGG - Intronic
1062111570 9:134785005-134785027 GCCATCTTCTCCCCTGGGACCGG - Exonic
1062598594 9:137310141-137310163 GCCTCCCACTGCCCTGGGGCAGG + Intronic
1203364291 Un_KI270442v1:243676-243698 ACCGCCTTCTTCAGTGGGACGGG + Intergenic
1187127390 X:16466896-16466918 GGCTCCACCTTCCCAGGGACTGG + Intergenic
1187725086 X:22194081-22194103 GCCTTTTTCTTGCCTGGGAAGGG + Intronic
1188156688 X:26749495-26749517 GGCCCCACCTTCCCTGGGACTGG - Intergenic
1189145702 X:38652701-38652723 CCCTTCTCCTTTCCTGGGACGGG - Intronic
1190284754 X:48954715-48954737 GCTTTTTTCTTCCCAGGGACAGG - Intronic
1190335226 X:49258054-49258076 GCCTCCTCCTCTCCTGAGACAGG + Intronic
1190503088 X:51098310-51098332 GGCTCTGTCTTCCCTGGAACAGG - Intergenic
1190771883 X:53521681-53521703 CCCTGATTCTTCCCTGGGAGTGG + Intergenic
1199520338 X:148728207-148728229 GCCTTAGCCTTCCCTGGGACTGG + Intronic
1200074950 X:153546272-153546294 TCCTCCCTCTGCACTGGGACGGG - Intronic
1200216514 X:154370510-154370532 GCCTCCTCCTCCTCGGGGACGGG + Intronic
1202148299 Y:21822621-21822643 GCCTCCTCCTCCAGTGGGACCGG + Intergenic