ID: 1080587512

View in Genome Browser
Species Human (GRCh38)
Location 11:33695118-33695140
Sequence CTGGCCAGCCTGAAGTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080587501_1080587512 7 Left 1080587501 11:33695088-33695110 CCCACCCTGCGCCCTTCACTGCC No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587508_1080587512 -5 Left 1080587508 11:33695100-33695122 CCTTCACTGCCCTCTGGCCTGGC No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587503_1080587512 3 Left 1080587503 11:33695092-33695114 CCCTGCGCCCTTCACTGCCCTCT No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587500_1080587512 8 Left 1080587500 11:33695087-33695109 CCCCACCCTGCGCCCTTCACTGC No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587502_1080587512 6 Left 1080587502 11:33695089-33695111 CCACCCTGCGCCCTTCACTGCCC No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587506_1080587512 -4 Left 1080587506 11:33695099-33695121 CCCTTCACTGCCCTCTGGCCTGG No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587499_1080587512 9 Left 1080587499 11:33695086-33695108 CCCCCACCCTGCGCCCTTCACTG No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587504_1080587512 2 Left 1080587504 11:33695093-33695115 CCTGCGCCCTTCACTGCCCTCTG No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data
1080587498_1080587512 12 Left 1080587498 11:33695083-33695105 CCACCCCCACCCTGCGCCCTTCA No data
Right 1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080587512 Original CRISPR CTGGCCAGCCTGAAGTTTTC TGG Intergenic
No off target data available for this crispr