ID: 1080588325

View in Genome Browser
Species Human (GRCh38)
Location 11:33700491-33700513
Sequence GACCCAGGCCGGGTGGTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1688
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 1628}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080588314_1080588325 9 Left 1080588314 11:33700459-33700481 CCAGGGCGAGGGCCAGGGGCGCT 0: 1
1: 0
2: 1
3: 41
4: 347
Right 1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG 0: 1
1: 0
2: 3
3: 56
4: 1628
1080588310_1080588325 17 Left 1080588310 11:33700451-33700473 CCGGAGGGCCAGGGCGAGGGCCA 0: 1
1: 1
2: 6
3: 46
4: 357
Right 1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG 0: 1
1: 0
2: 3
3: 56
4: 1628
1080588307_1080588325 22 Left 1080588307 11:33700446-33700468 CCAGGCCGGAGGGCCAGGGCGAG 0: 1
1: 0
2: 0
3: 49
4: 1518
Right 1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG 0: 1
1: 0
2: 3
3: 56
4: 1628
1080588318_1080588325 -3 Left 1080588318 11:33700471-33700493 CCAGGGGCGCTCGCTGGAGGGAC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG 0: 1
1: 0
2: 3
3: 56
4: 1628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080588325 Original CRISPR GACCCAGGCCGGGTGGTGGC GGG Exonic
900494783 1:2971499-2971521 TACCCAGGCGGGGAGGAGGCAGG - Intergenic
900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG + Intronic
900700680 1:4047002-4047024 CACCCAGCCCTGGTGGGGGCAGG - Intergenic
900801028 1:4737208-4737230 AACCCAGGCTGGGAGGAGGCTGG + Intronic
900963914 1:5944380-5944402 GGCCCAGGGCGGGCTGTGGCAGG - Intronic
900972048 1:5997156-5997178 GCTCCAGGCAGGATGGTGGCTGG - Intronic
901018448 1:6244451-6244473 GACTCAGGCGGGGTGGGGGTGGG + Intronic
901030511 1:6304915-6304937 CTCCCAGACAGGGTGGTGGCCGG + Intronic
901030812 1:6305773-6305795 TTCCCAGACGGGGTGGTGGCCGG + Intronic
901100330 1:6715028-6715050 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
901284522 1:8066587-8066609 GTCCCAGGTCCGGTGGGGGCAGG - Intergenic
901555515 1:10028753-10028775 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
901635082 1:10666737-10666759 GTCCCAGGCTGTGTGGTGGGTGG - Intronic
901726920 1:11249939-11249961 CTCCCAGACGGGGTGGTGGCCGG + Intronic
901763795 1:11487490-11487512 GTCCCAGGCAAGGTGGTGGCAGG - Intronic
901849791 1:12008269-12008291 CTCCCAGACGGGGTGGTGGCCGG + Intronic
902027458 1:13394797-13394819 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
903081846 1:20816716-20816738 CTCCCAGACGGGGTGGTGGCCGG - Intronic
903103646 1:21053943-21053965 CTCCCAGACGGGGTGGTGGCCGG - Intronic
903148624 1:21389228-21389250 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
903162908 1:21502556-21502578 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
903458464 1:23504444-23504466 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
903485957 1:23689226-23689248 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
903508273 1:23853537-23853559 CTCCCAGACGGGGTGGTGGCTGG - Intronic
903525009 1:23987056-23987078 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
903525818 1:23993240-23993262 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
903748630 1:25604420-25604442 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
903894662 1:26595888-26595910 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
903921334 1:26803401-26803423 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
903924084 1:26819137-26819159 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
904078057 1:27854557-27854579 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
904140348 1:28348154-28348176 TAGCCAGGCGTGGTGGTGGCGGG + Intergenic
904333739 1:29784144-29784166 GCCCCAGGCCTGGTGGTTTCTGG - Intergenic
904533881 1:31186569-31186591 GAACCAGGGCAGGTGGAGGCAGG + Intronic
904795447 1:33052940-33052962 CTCCCAGACGGGGTGGTGGCCGG - Intronic
904857244 1:33509166-33509188 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
905057084 1:35105281-35105303 TAGCCAGGCGTGGTGGTGGCGGG - Intronic
905058523 1:35119849-35119871 GAGCCAGGCGTGGTGGTGGCAGG + Intergenic
905128446 1:35733111-35733133 CAGCCAGGCTTGGTGGTGGCAGG - Intronic
905427260 1:37895924-37895946 TTCCCAGACGGGGTGGTGGCCGG - Intronic
905427702 1:37897207-37897229 CTCCCAGACGGGGTGGTGGCCGG - Intronic
905527166 1:38647786-38647808 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
905599003 1:39234310-39234332 CTCCCAGACGGGGTGGTGGCCGG + Intronic
905686538 1:39912996-39913018 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
905699433 1:40000098-40000120 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
905881375 1:41466425-41466447 GAGCCAGGCTAGGTGGTGGCTGG + Intergenic
906136321 1:43502434-43502456 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
906215044 1:44033798-44033820 GGCCCAGCCCGGGTGGGAGCTGG + Intergenic
906353322 1:45081801-45081823 CTCCCAGACGGGGTGGTGGCCGG - Intronic
906400038 1:45497854-45497876 CTCCCAGACGGGGTGGTGGCCGG - Intronic
906429089 1:45740343-45740365 CTCCCAGACAGGGTGGTGGCTGG + Intronic
906487410 1:46242408-46242430 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
906544533 1:46611970-46611992 GCTCCAGGCCAGGTGGGGGCTGG + Intronic
906741865 1:48192152-48192174 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
906742191 1:48193102-48193124 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
907032704 1:51187933-51187955 GAGCCAGGCAGTGTGGTGGTAGG + Intergenic
907089485 1:51711227-51711249 CTCCCAGACGGGGTGGTGGCCGG + Intronic
907089727 1:51711997-51712019 TTCCCAGACGGGGTGGTGGCCGG + Intronic
907140712 1:52182223-52182245 CTCCCAGACGGGGTGGTGGCCGG - Intronic
907155281 1:52327823-52327845 GAATTAGCCCGGGTGGTGGCGGG + Intronic
907216527 1:52869765-52869787 CTCCCAGACGGGGTGGTGGCTGG + Intronic
907333785 1:53687666-53687688 GACCCTGGCTGGGTGGTGGGCGG - Intronic
907402638 1:54233823-54233845 CTCCCAGACGGGGTGGTGGCCGG - Intronic
907453378 1:54561623-54561645 CTCCCAGACAGGGTGGTGGCCGG + Intronic
908468247 1:64415995-64416017 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
909478774 1:76111959-76111981 CTCCCAGACGGGGTGGTGGCCGG + Intronic
910344160 1:86216791-86216813 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
910673677 1:89797724-89797746 CTCCCAGACGGGGTGGTGGCCGG + Intronic
910815747 1:91289174-91289196 CTCCCAGACGGGGTGGTGGCGGG + Intronic
911325771 1:96469616-96469638 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
911351563 1:96762250-96762272 CTCCCAGACGGGGTGGTGGCCGG + Intronic
911486452 1:98512304-98512326 CTCCCAGCCGGGGTGGTGGCTGG + Intergenic
911569714 1:99508078-99508100 TTCCCAGACAGGGTGGTGGCTGG - Intergenic
911598658 1:99823885-99823907 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
912116227 1:106412247-106412269 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
912298029 1:108488866-108488888 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
912317117 1:108676173-108676195 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
912371413 1:109177126-109177148 CTCCCAGACAGGGTGGTGGCCGG + Intronic
912546907 1:110457482-110457504 GACCCTGGCCGGGTTGGGGAAGG - Intergenic
912629385 1:111233665-111233687 CTCCCAGACGGGGTGGTGGCCGG - Intronic
912690306 1:111800015-111800037 CTCCCAGACGGGGTGGTGGCCGG - Intronic
912808389 1:112774434-112774456 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
912845372 1:113070606-113070628 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
913021067 1:114790482-114790504 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
913305740 1:117429323-117429345 CTCCCAGACGGGGTGGTGGCCGG + Intronic
914002441 1:143703612-143703634 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
914231251 1:145766515-145766537 CTCCCAGACGGGGTGGTGGCCGG + Intronic
914392311 1:147233569-147233591 CTCCCAGACGGGGTGGTGGCCGG - Intronic
914467965 1:147949281-147949303 CTCCCAGACAGGGTGGTGGCTGG + Intronic
914702831 1:150149983-150150005 GACCCGGGCCGCGTGGGCGCCGG + Exonic
914774971 1:150728469-150728491 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
914780710 1:150781999-150782021 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
914889883 1:151612678-151612700 GCCCCGGGGCGGGTGGTGGGAGG - Intronic
914893708 1:151651122-151651144 CTCCCAGACGGGGTGGTGGCCGG + Intronic
914909061 1:151769659-151769681 TTCCCAGACGGGGTGGTGGCCGG + Intronic
914947306 1:152078985-152079007 TTCCCAGACAGGGTGGTGGCTGG + Intergenic
914953852 1:152144659-152144681 CTCCCAGACAGGGTGGTGGCTGG + Intergenic
914959733 1:152195994-152196016 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
914965715 1:152256106-152256128 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
914987280 1:152471925-152471947 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
915113991 1:153583370-153583392 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
915208463 1:154287885-154287907 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
915242461 1:154533055-154533077 CACCCAGGCAGGGTGGTGGTAGG + Intronic
915411081 1:155701152-155701174 CTCCCAGACGGGGTGGTGGCCGG - Intronic
915426953 1:155834951-155834973 CTCCCAGACGGGGTGGTGGCCGG - Intronic
915487533 1:156232251-156232273 TACCCAGGCAGGCTGATGGCCGG + Intronic
915601141 1:156924042-156924064 GACGAAGGGCGGGTGGGGGCGGG - Exonic
915945870 1:160151568-160151590 GTCCCAGGCCCTGTGGTTGCTGG - Exonic
916050139 1:161029922-161029944 GTCCCAGACGGGGTGGCGGCCGG - Intronic
916105084 1:161423773-161423795 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
916223486 1:162466290-162466312 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
916324897 1:163546024-163546046 CTCCCAGACCGGGTGGCGGCCGG + Intergenic
916756074 1:167771594-167771616 TTCCCAGACGGGGTGGTGGCCGG + Intronic
916759819 1:167806283-167806305 TTCCCAGACAGGGTGGTGGCCGG + Intergenic
917006311 1:170419353-170419375 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
917304770 1:173613743-173613765 CTCCCAGACGGGGTGGTGGCCGG - Intronic
917375528 1:174348979-174349001 CTCCCAGACGGGGTGGTGGCCGG + Intronic
917553400 1:176058241-176058263 CTCCCAGACGGGGTGGTGGCCGG - Intronic
917582724 1:176395793-176395815 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
917848196 1:179040253-179040275 CTCCCAGACGGGGTGGTGGCCGG + Intronic
917860164 1:179136183-179136205 CTCCCAGACGGGGTGGTGGCCGG - Intronic
917889013 1:179418510-179418532 CTCCCAGACGGGGTGGTGGCCGG + Intronic
917901420 1:179546791-179546813 GAGCCAGGCCTGGTGGTTGAGGG - Intronic
918221360 1:182439778-182439800 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
918228497 1:182509207-182509229 CTCCCAGACGGGGTGGTGGCCGG + Intronic
918254989 1:182741075-182741097 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
918619868 1:186590803-186590825 TAGCCAGGCATGGTGGTGGCAGG + Intergenic
918818901 1:189226046-189226068 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
919080292 1:192857858-192857880 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
919423978 1:197406049-197406071 CTCCCAGACGGGGTGGTGGCCGG - Intronic
919809352 1:201399175-201399197 GTCCCAGGCGGGGAGGAGGCCGG + Intronic
919959359 1:202451691-202451713 CTCCCAGACGGGGTGGTGGCCGG + Intronic
919994862 1:202739995-202740017 CTCCCAGACGGGGTGGTGGCCGG + Intronic
920143839 1:203841674-203841696 CTCCCAGACGGGGTGGTGGCTGG + Intronic
920152127 1:203919086-203919108 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
920749382 1:208659457-208659479 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
920795118 1:209129676-209129698 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
921142306 1:212320466-212320488 CTCCCAGACGGGGTGGTGGCTGG + Intronic
921237682 1:213150834-213150856 CTCCCAGACGGGGTGGTGGCCGG + Intronic
921413970 1:214869121-214869143 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
921638271 1:217523694-217523716 CTCCCAGACGGGGTGGTGGCCGG + Intronic
921902580 1:220466204-220466226 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
922102370 1:222487410-222487432 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
922503702 1:226114820-226114842 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
922673433 1:227532560-227532582 GACTCAGGGCTGTTGGTGGCAGG - Intergenic
922692962 1:227710523-227710545 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
922992992 1:229931837-229931859 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
923792892 1:237127305-237127327 CTCCCAGACAGGGTGGTGGCCGG + Intronic
924178315 1:241415712-241415734 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
924336228 1:242989140-242989162 GGGCCAGGCTGGGTGGGGGCGGG + Intergenic
924692349 1:246363394-246363416 CTCCCAGACGGGGTGGTGGCCGG - Intronic
924766158 1:247032763-247032785 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
924788430 1:247220720-247220742 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
1062860525 10:806114-806136 GATCCAGGCCGGAGGGTGGGTGG + Intergenic
1063438816 10:6055724-6055746 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1063459511 10:6206473-6206495 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1063547106 10:6992020-6992042 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1063674837 10:8131674-8131696 GCCGAAGGCCAGGTGGTGGCTGG - Intergenic
1064108181 10:12519008-12519030 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1064108984 10:12522718-12522740 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1064109184 10:12523329-12523351 TTCCCAGACAGGGTGGTGGCCGG + Intronic
1064601694 10:17000062-17000084 GACCCAGGCTGGCTGGATGCAGG - Intronic
1065012305 10:21430673-21430695 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1065336469 10:24657524-24657546 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1065594161 10:27296082-27296104 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1065840590 10:29697290-29697312 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1066402495 10:35089962-35089984 GATCCAGTCCAGGGGGTGGCAGG + Exonic
1066437320 10:35406750-35406772 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1066952976 10:42138474-42138496 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1067026615 10:42847809-42847831 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1067055071 10:43045393-43045415 GGCCCAGGCCCAGCGGTGGCAGG + Intergenic
1067117358 10:43446198-43446220 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1067119850 10:43464890-43464912 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1067282062 10:44880383-44880405 GAGCCAGGCCTGGAGCTGGCAGG - Intergenic
1067325354 10:45260469-45260491 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1067331927 10:45330601-45330623 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1067354656 10:45512698-45512720 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1067477999 10:46578928-46578950 GGCCCAGGCCCGGCGGTGGAGGG - Intronic
1067616740 10:47762859-47762881 GGCCCAGGCCCGGCGGTGGAGGG + Intergenic
1068005859 10:51392652-51392674 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1068668124 10:59697206-59697228 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1068673311 10:59744584-59744606 CTCCCAGACCGGGTGGCGGCTGG - Intergenic
1069052791 10:63812048-63812070 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1069365870 10:67692213-67692235 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1069733068 10:70631472-70631494 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1069740910 10:70686806-70686828 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1069817703 10:71209151-71209173 GCCCCAGGCGGGGTGGGGCCAGG + Intergenic
1069928746 10:71869179-71869201 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1069929944 10:71875667-71875689 CTCCCAGACCGGGTGGTGGCCGG + Intergenic
1070135576 10:73690081-73690103 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1070317823 10:75332996-75333018 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1070807419 10:79278957-79278979 CTCCCAGACAGGGTGGTGGCGGG + Intronic
1070966832 10:80535037-80535059 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1071465847 10:85939090-85939112 GTCCCAGGCCGCCTGGTGCCTGG + Intronic
1071506570 10:86235305-86235327 GACCCAGGCCTGGAGAAGGCTGG + Intronic
1071509267 10:86250818-86250840 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1072013256 10:91323009-91323031 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1072117370 10:92376906-92376928 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1072149481 10:92674251-92674273 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1072160077 10:92757915-92757937 GATCCAGACCGTGAGGTGGCAGG + Intergenic
1072648862 10:97277070-97277092 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1072680376 10:97501439-97501461 TAGCCAGGCATGGTGGTGGCAGG + Intronic
1072684178 10:97527968-97527990 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1072949251 10:99837993-99838015 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1072956605 10:99892231-99892253 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1072980617 10:100094018-100094040 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1073000135 10:100278306-100278328 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1073081640 10:100864494-100864516 GACCCTGGCAGGGTGGAGGAGGG - Intergenic
1073238333 10:102036349-102036371 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1073325539 10:102642588-102642610 CTCCCAGGCCGGGCCGTGGCGGG + Intergenic
1073385958 10:103128477-103128499 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1073386552 10:103130028-103130050 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1073450808 10:103607625-103607647 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1073511203 10:104043640-104043662 GACCCAAGCCAGGTTGTGGTGGG + Intronic
1073594293 10:104784967-104784989 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1073865669 10:107801006-107801028 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1074151885 10:110766846-110766868 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1074981064 10:118620299-118620321 AGCCCAGGTGGGGTGGTGGCTGG - Intergenic
1075050759 10:119181826-119181848 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1075061583 10:119260926-119260948 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1075128984 10:119722549-119722571 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1075136869 10:119794540-119794562 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1075166922 10:120077002-120077024 GACCAAGCCCGGCTGGAGGCTGG + Intergenic
1075181348 10:120214986-120215008 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1075407198 10:122203180-122203202 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1076721438 10:132395144-132395166 AACCAAGGCTGGGTGGCGGCGGG - Intergenic
1076736331 10:132460835-132460857 CACCCAGGCCAGGTGGGGACAGG - Intergenic
1076786494 10:132752357-132752379 GCCACAGGTAGGGTGGTGGCAGG + Intronic
1076843890 10:133059762-133059784 GACCCAGGCTGAGTGGGGGGTGG - Intergenic
1076889675 10:133277377-133277399 GTCCCAGCCCAGGTGATGGCAGG + Intergenic
1076914337 10:133414436-133414458 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1077061725 11:620488-620510 GGCCCAGTCCCGCTGGTGGCCGG + Intronic
1077331501 11:1985812-1985834 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1077680684 11:4237582-4237604 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1077837052 11:5934689-5934711 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1078316086 11:10294252-10294274 GAGCCAGCGCGGGTGGGGGCGGG - Intergenic
1078454256 11:11462843-11462865 GACCCCTCCCGGGTGGTGGAGGG - Intronic
1079020857 11:16907737-16907759 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1079039623 11:17050122-17050144 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1079371768 11:19859661-19859683 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1080098399 11:28431253-28431275 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1080171269 11:29306022-29306044 GTTCCAGCCAGGGTGGTGGCAGG - Intergenic
1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG + Exonic
1080860393 11:36145479-36145501 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1081237128 11:40659289-40659311 GAAGGAGGCTGGGTGGTGGCAGG + Intronic
1081289307 11:41305377-41305399 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1081627510 11:44664097-44664119 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1081784557 11:45738047-45738069 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1081956583 11:47097780-47097802 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1082244987 11:49911614-49911636 AACCCAGACGGGGTGGTGGCTGG + Intergenic
1082678896 11:56144032-56144054 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1082844443 11:57716103-57716125 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1083036775 11:59645301-59645323 CTCCCAGACGGGGTGGTGGCAGG + Intronic
1083115148 11:60451871-60451893 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1083154824 11:60815830-60815852 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1083208185 11:61166278-61166300 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1083382748 11:62279768-62279790 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1083391723 11:62356142-62356164 CTCCCAGACAGGGTGGTGGCGGG + Intronic
1083645605 11:64171272-64171294 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1083775203 11:64891270-64891292 CTCCCAGGCCAGATGGTGGCGGG - Intergenic
1083832194 11:65239776-65239798 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1083856305 11:65394663-65394685 GACCCTGGCCGGCAGGAGGCAGG - Intronic
1083865788 11:65451945-65451967 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1083962693 11:66023115-66023137 GAGCCAGGCTGGGGGGTGCCTGG - Intronic
1084049247 11:66588568-66588590 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1084055737 11:66631431-66631453 TAGCCAGGCGAGGTGGTGGCAGG - Intronic
1084140189 11:67222594-67222616 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1084166268 11:67376099-67376121 GACCCAGGCCAGGTGGGTACAGG + Intronic
1084186902 11:67477951-67477973 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1084206523 11:67597998-67598020 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1084318359 11:68358906-68358928 GGCCCAGGCAGGGATGTGGCAGG + Intronic
1084338289 11:68475434-68475456 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1084624113 11:70295075-70295097 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1084651061 11:70489875-70489897 ACTCCAGGCCTGGTGGTGGCTGG + Intronic
1084745448 11:71167308-71167330 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1084839156 11:71831237-71831259 TTCCCAGACGGGGTGGTGGCTGG - Intergenic
1084843736 11:71882375-71882397 TAGCCAGGCGTGGTGGTGGCTGG - Intronic
1084924517 11:72502034-72502056 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1084924904 11:72503125-72503147 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1084955573 11:72689504-72689526 GAGCCATGCCTGGTGGTGGCTGG - Intronic
1085111834 11:73896818-73896840 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1085116402 11:73936107-73936129 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1085139614 11:74129066-74129088 CTCCCAGACAGGGTGGTGGCCGG + Intronic
1085313215 11:75528298-75528320 GTACCAGGCTGGATGGTGGCGGG - Intergenic
1085359836 11:75877370-75877392 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1085443306 11:76582494-76582516 CACCCAGTCCGGGAGGTGGGGGG - Intergenic
1085480960 11:76821822-76821844 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1085512987 11:77097991-77098013 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1085563104 11:77489860-77489882 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1085721367 11:78915031-78915053 GACTCATGCCGGATGGTGGGGGG - Intronic
1085754623 11:79192240-79192262 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1086017342 11:82182337-82182359 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1086122250 11:83316127-83316149 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1086447147 11:86879919-86879941 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1086697357 11:89861072-89861094 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1086708802 11:89983415-89983437 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1086792959 11:91063962-91063984 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1086881774 11:92158383-92158405 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1087057021 11:93946608-93946630 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1087101377 11:94368592-94368614 GAACCAGTTCTGGTGGTGGCTGG + Intergenic
1087198104 11:95320750-95320772 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1087948828 11:104195100-104195122 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
1088116170 11:106317202-106317224 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1088658828 11:112026835-112026857 CTCCCAGACAGGGTGGTGGCCGG + Intronic
1089420635 11:118330806-118330828 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1089585404 11:119507510-119507532 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1089976045 11:122732265-122732287 GACCAAGGCCGGCTGGCTGCTGG + Intronic
1090181640 11:124704803-124704825 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1090323410 11:125864144-125864166 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1090327540 11:125902357-125902379 GGCCAAGACGGGGTGGTGGCGGG + Intronic
1090709949 11:129375434-129375456 GAGCCGGGCCGGCGGGTGGCAGG + Intergenic
1090785454 11:130044147-130044169 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1090790663 11:130090784-130090806 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1202814482 11_KI270721v1_random:40988-41010 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1091553514 12:1554546-1554568 TACCCAGGCCAGGTGCTGCCTGG + Intronic
1091586115 12:1817895-1817917 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1091586208 12:1818244-1818266 CTCCCAGACTGGGTGGTGGCCGG - Intronic
1091762243 12:3095391-3095413 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1092185394 12:6475326-6475348 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1092331219 12:7589698-7589720 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1092591262 12:9953683-9953705 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1092850086 12:12618615-12618637 TTCCCAGGCGGGGTGGCGGCCGG + Intronic
1092974477 12:13730973-13730995 GACACAGGCCTGGTGGAGACAGG - Intronic
1093412780 12:18886550-18886572 GAGCCAGACTGCGTGGTGGCTGG + Intergenic
1093453386 12:19340426-19340448 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1094103163 12:26784753-26784775 TTCCCAGACGGGGTGGTGGCTGG - Intronic
1094238895 12:28200795-28200817 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1094493411 12:30975384-30975406 GACTGAGGCCGGGTGCTGGTGGG - Intronic
1094520382 12:31180764-31180786 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1094564994 12:31591041-31591063 GAGCCCGGCCGGGTGGGGGAGGG + Exonic
1094670239 12:32562934-32562956 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1094716876 12:33022690-33022712 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1094717043 12:33023213-33023235 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1094747531 12:33362823-33362845 TAGCCAGGCCTGGTGGTGGTGGG + Intergenic
1095439993 12:42228885-42228907 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1095452846 12:42350238-42350260 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1096021890 12:48332222-48332244 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1096039249 12:48500245-48500267 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1096044579 12:48551650-48551672 TTCCCAGACAGGGTGGTGGCCGG - Intergenic
1096054870 12:48642350-48642372 ATCCCAGACGGGGTGGTGGCTGG - Intergenic
1096054882 12:48642390-48642412 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1096063876 12:48724477-48724499 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1096078341 12:48818451-48818473 GATCCAGGCAGGGAGGAGGCGGG - Intronic
1096092942 12:48915632-48915654 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1096146657 12:49283506-49283528 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1096167200 12:49436163-49436185 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1096167659 12:49437413-49437435 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1096225156 12:49861458-49861480 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1096441280 12:51645429-51645451 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1096557141 12:52410164-52410186 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1096660754 12:53122853-53122875 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1096951499 12:55478983-55479005 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1097028410 12:56075616-56075638 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1097126804 12:56783162-56783184 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1097127759 12:56788977-56788999 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1097138489 12:56879379-56879401 CTCCCAGACAGGGTGGTGGCTGG - Intergenic
1097149256 12:56963997-56964019 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1097228540 12:57495096-57495118 CACCCAGCCCGGGAGGTGGGGGG - Intronic
1097779618 12:63687061-63687083 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1098019273 12:66135535-66135557 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1098370834 12:69759504-69759526 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1098884054 12:75942586-75942608 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1099255187 12:80307328-80307350 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1100048209 12:90411137-90411159 CTCCCAGGCGGGGTGGCGGCGGG - Intergenic
1100507351 12:95235178-95235200 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1100577496 12:95907344-95907366 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1100582532 12:95948604-95948626 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1100606819 12:96158375-96158397 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1100845642 12:98655350-98655372 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1100994898 12:100294049-100294071 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1101317691 12:103644005-103644027 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1101834315 12:108284638-108284660 TACCCAGGACAGGTAGTGGCAGG - Intergenic
1101885099 12:108655791-108655813 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1102174547 12:110866839-110866861 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1102268381 12:111507634-111507656 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1102293786 12:111722906-111722928 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1102323465 12:111957749-111957771 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1102578863 12:113873153-113873175 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1102996625 12:117356423-117356445 GACCCAGGACAGGTGGTTGAAGG - Intronic
1103234361 12:119360054-119360076 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1103299637 12:119918326-119918348 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1103350197 12:120278444-120278466 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1103413964 12:120732156-120732178 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1103457454 12:121077099-121077121 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1103535975 12:121634211-121634233 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1103591561 12:121994431-121994453 GTCCCAGACGGGGTGGTGGCCGG - Intronic
1103641895 12:122357912-122357934 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1103682878 12:122708776-122708798 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1103872740 12:124102527-124102549 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1104029341 12:125053448-125053470 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1104712415 12:130996297-130996319 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1104861395 12:131926255-131926277 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1105248566 13:18674180-18674202 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1105526906 13:21186237-21186259 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1105556214 13:21448691-21448713 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1105692760 13:22858928-22858950 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1105921675 13:24970194-24970216 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1105980252 13:25512401-25512423 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1106104908 13:26724289-26724311 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1106114545 13:26806190-26806212 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1106495463 13:30270395-30270417 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1106559898 13:30839104-30839126 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1106680293 13:32000597-32000619 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1106746716 13:32716071-32716093 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1106799535 13:33242225-33242247 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1106885661 13:34181599-34181621 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1106918927 13:34541442-34541464 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1107166029 13:37280861-37280883 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1107499204 13:40956046-40956068 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1107692538 13:42966752-42966774 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1107737761 13:43416639-43416661 ATCCCAGACCGGGTGGTGGCGGG + Intronic
1107863392 13:44682284-44682306 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1108059103 13:46515415-46515437 CTCCCAGACGGGGTGGTGGCGGG + Intergenic
1108330655 13:49379169-49379191 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1108341845 13:49504688-49504710 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1108351640 13:49593697-49593719 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1108502145 13:51078384-51078406 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
1108608881 13:52064595-52064617 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1108610640 13:52080365-52080387 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1109034395 13:57235890-57235912 CACCCAGGCCTGTTGGTGGGTGG + Intergenic
1110269700 13:73575680-73575702 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1110922250 13:81102483-81102505 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1111418108 13:87976131-87976153 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1112055872 13:95690506-95690528 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1112056266 13:95691639-95691661 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1112420252 13:99242258-99242280 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1112590787 13:100762031-100762053 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1113194210 13:107783336-107783358 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1113254858 13:108495765-108495787 CAGCCAGGCCGGCTGGAGGCTGG - Intergenic
1114165405 14:20213245-20213267 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1114191599 14:20443275-20443297 CTCCCAGACCGGGTGGCGGCCGG - Intergenic
1114280501 14:21188939-21188961 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
1114416609 14:22549058-22549080 GGCCTGGGCAGGGTGGTGGCAGG + Intergenic
1114428355 14:22639458-22639480 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1115259278 14:31436930-31436952 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1115504365 14:34079261-34079283 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1115609992 14:35039732-35039754 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1115688815 14:35824475-35824497 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1116005172 14:39285271-39285293 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1116191404 14:41673236-41673258 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1116409203 14:44601707-44601729 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1116480815 14:45390303-45390325 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1116841342 14:49821782-49821804 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1116871756 14:50074385-50074407 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1117277464 14:54204376-54204398 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1117411614 14:55456216-55456238 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1117597079 14:57334270-57334292 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1117716710 14:58588622-58588644 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1117763623 14:59058810-59058832 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1118148873 14:63166291-63166313 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1118209181 14:63750939-63750961 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1118238833 14:64037652-64037674 CTCCCAGACAGGGTGGTGGCCGG + Intronic
1118423642 14:65634037-65634059 CTCCCAGACCGGGTGGTGGCCGG - Intronic
1118428362 14:65692122-65692144 CTCCCAGACCGGGTGGTGGCCGG + Intronic
1118517365 14:66545099-66545121 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1118584611 14:67341085-67341107 TTCCCAGACCGGGTGGCGGCTGG - Intronic
1118584798 14:67341658-67341680 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1119208030 14:72809341-72809363 GGACCAGGCCTGGTGTTGGCAGG - Intronic
1119254148 14:73183818-73183840 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1119322697 14:73741033-73741055 AACCCTGGCAGGGTGGAGGCAGG + Intronic
1119476875 14:74935416-74935438 GCCCCAGACAGGGTGGTGACAGG - Intergenic
1119594793 14:75924804-75924826 CTCCCAGACCGGGTGGTGGCCGG + Intronic
1119616189 14:76100630-76100652 GACCCAGGGAGGGTGCGGGCAGG - Intergenic
1119700474 14:76750846-76750868 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1119722110 14:76898453-76898475 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1119760123 14:77144568-77144590 GAGTCAGGGTGGGTGGTGGCAGG - Intronic
1119798005 14:77416723-77416745 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1119806676 14:77486712-77486734 TACCCTAGCCTGGTGGTGGCTGG + Intronic
1119868442 14:77993545-77993567 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1120309735 14:82814140-82814162 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1120892788 14:89505686-89505708 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1120893113 14:89506599-89506621 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1121142681 14:91557054-91557076 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
1121306522 14:92911233-92911255 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1121531664 14:94658357-94658379 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1122077622 14:99246157-99246179 GACCCAGGCCGAGTGGGGGAGGG + Intronic
1122212461 14:100181403-100181425 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1122238328 14:100345145-100345167 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1122306758 14:100771318-100771340 GGCCCAGGCTGGGGGCTGGCTGG + Intergenic
1122411596 14:101528661-101528683 GACTGAGGCAGGGTGGGGGCAGG + Intergenic
1122497817 14:102172428-102172450 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1122691667 14:103534683-103534705 TGCCCAGGTCGGGCGGTGGCAGG - Exonic
1122882112 14:104694862-104694884 GGCACAGGCAGGGTGGGGGCTGG + Intronic
1122957697 14:105079120-105079142 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1122963503 14:105111303-105111325 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1202848165 14_GL000009v2_random:200280-200302 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1202917674 14_GL000194v1_random:190949-190971 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1123996416 15:25721006-25721028 GCCCCAGGCACAGTGGTGGCGGG + Intronic
1124245988 15:28070636-28070658 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1125017073 15:34946984-34947006 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1125079594 15:35657045-35657067 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
1125459319 15:39893624-39893646 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1125459756 15:39894804-39894826 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1125566927 15:40683721-40683743 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1125641986 15:41238701-41238723 TAGCCAGGCATGGTGGTGGCAGG + Intronic
1125651597 15:41321397-41321419 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1125659603 15:41383508-41383530 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1125861722 15:43005565-43005587 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1125862987 15:43015116-43015138 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1125874639 15:43133498-43133520 GACGGTGGCCGAGTGGTGGCGGG - Intronic
1125877909 15:43167056-43167078 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1126125629 15:45292930-45292952 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1126516922 15:49549840-49549862 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1126571682 15:50158578-50158600 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1126573166 15:50172826-50172848 CTCCCAGACGGGGTGGTGGCGGG - Intronic
1126692001 15:51294795-51294817 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1126693922 15:51310019-51310041 TTCCCTGGCCTGGTGGTGGCAGG - Intronic
1126799526 15:52286414-52286436 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1127073353 15:55303936-55303958 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1127154637 15:56111121-56111143 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1127192043 15:56540781-56540803 TTCCCAGGCAGGGTGGCGGCTGG - Intergenic
1127471534 15:59294804-59294826 GCCCCAGGCAGACTGGTGGCAGG - Intronic
1127782805 15:62332095-62332117 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1127874385 15:63099252-63099274 GTTCCAGACGGGGTGGTGGCCGG - Intergenic
1128071238 15:64798941-64798963 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1128112722 15:65086759-65086781 ACCCCAGGCCTGGTGGGGGCAGG - Intergenic
1128489579 15:68134255-68134277 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1128566695 15:68705484-68705506 GACCCAGGGAGGGAAGTGGCTGG + Intronic
1128597254 15:68964196-68964218 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1128970651 15:72101962-72101984 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1129008928 15:72397118-72397140 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1129341251 15:74888321-74888343 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1129428676 15:75481931-75481953 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1129431129 15:75503047-75503069 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1129438242 15:75559246-75559268 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1129445612 15:75615748-75615770 TAGCCAGGCGTGGTGGTGGCAGG - Intronic
1129776141 15:78237664-78237686 GGCCAATGCCAGGTGGTGGCAGG + Intronic
1130340570 15:82997723-82997745 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1130428129 15:83821763-83821785 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1130522490 15:84673227-84673249 CTCCCAGACCGGGTGGTGGCCGG - Intronic
1130946104 15:88552244-88552266 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1130946823 15:88554063-88554085 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1131001135 15:88941269-88941291 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1131043739 15:89296715-89296737 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1131125694 15:89855000-89855022 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1131127076 15:89867423-89867445 TTCCCAGACCGGGTGGCGGCCGG - Intronic
1131127677 15:89869044-89869066 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1131479193 15:92767993-92768015 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1132423711 15:101696061-101696083 TAGCCAGGCATGGTGGTGGCAGG + Intronic
1132583817 16:697222-697244 CAGCCAGGCTGGGTGGTGGGAGG + Exonic
1132591138 16:726983-727005 GATCCGGGCCGGGCGGGGGCGGG + Intronic
1132619179 16:856280-856302 GACTGAGGCCAGGTGGTGCCAGG + Intronic
1132703560 16:1231741-1231763 GTCCCAGGCAGGGTGGGGGCAGG - Intergenic
1132704950 16:1239620-1239642 GTCCCAGGCAGGGTGGGGGCAGG + Intergenic
1132707957 16:1254654-1254676 GTCCCAGGCAGGGTGGGGGCAGG + Intergenic
1132777037 16:1599926-1599948 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1132785072 16:1652394-1652416 GAGCCAGGCCAGGTGGGGCCTGG - Intronic
1132870932 16:2115477-2115499 GGCGCAGGCCTGGGGGTGGCAGG + Exonic
1132879628 16:2156231-2156253 GACCCGGGCCGCGTGGTCGATGG - Intronic
1132894113 16:2219856-2219878 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1132921762 16:2399832-2399854 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1132992162 16:2801861-2801883 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1133030014 16:3006099-3006121 GGCCCAGCCCGGGTGGGGGTGGG - Intergenic
1133074686 16:3271322-3271344 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1133457385 16:5954321-5954343 AACTCAGGCCGGGTGGGGGTTGG + Intergenic
1133634946 16:7656421-7656443 GACCCAGGGCAGGAGCTGGCTGG + Intronic
1133659570 16:7903275-7903297 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1133680485 16:8115396-8115418 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1133751934 16:8732742-8732764 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1134082608 16:11335605-11335627 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1134521596 16:14921406-14921428 GGCGCAGGCCTGGGGGTGGCAGG - Intronic
1134674315 16:16078822-16078844 TAGCCAGGCGTGGTGGTGGCAGG - Intronic
1134709267 16:16320057-16320079 GGCGCAGGCCTGGGGGTGGCAGG - Intergenic
1134740215 16:16536376-16536398 GGGCCAGGCCTGGTGGAGGCTGG + Intergenic
1134927286 16:18175785-18175807 GGGCCAGGCCTGGTGGAGGCTGG - Intergenic
1134950338 16:18348588-18348610 GGCGCAGGCCTGGGGGTGGCAGG + Intergenic
1135014231 16:18910606-18910628 GACCAAGGCAGGGAGGTGGGTGG - Intronic
1135026590 16:19003505-19003527 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1135302602 16:21343933-21343955 ACCCCAGGCTGGGTGGTGGTTGG + Intergenic
1135639509 16:24108873-24108895 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1136160820 16:28417290-28417312 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1136197664 16:28665980-28666002 CTCCCAGCCGGGGTGGTGGCCGG + Intergenic
1136202146 16:28697710-28697732 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1136299363 16:29323149-29323171 ACCCCAGGCTGGGTGGTGGTTGG + Intergenic
1136331401 16:29579905-29579927 GACCAAGGCAGGGAGGTGGGTGG - Intergenic
1136426401 16:30170386-30170408 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1136583682 16:31169776-31169798 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1136611452 16:31369128-31369150 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1136618239 16:31411232-31411254 GACCTAGGCTGGGTGGGGTCCGG + Intronic
1136668698 16:31836871-31836893 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1136716498 16:32287247-32287269 GACCCAGCCTGGGTGGAGGATGG - Intergenic
1136834884 16:33493525-33493547 GACCCAGCCTGGGTGGGGGATGG - Intergenic
1137244853 16:46694380-46694402 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1137284078 16:47000764-47000786 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1137522913 16:49210177-49210199 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
1137772399 16:51026950-51026972 GACCCAGGCCTGGTGGAAGTTGG - Intergenic
1138028372 16:53539733-53539755 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1138037832 16:53625617-53625639 GTCCCAGACGGGGTGGCGGCTGG - Intronic
1138043681 16:53698862-53698884 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138400138 16:56739236-56739258 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1138466981 16:57200426-57200448 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG + Intronic
1138642087 16:58395852-58395874 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1138699219 16:58846019-58846041 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1139378328 16:66514645-66514667 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1139510968 16:67428419-67428441 GACCAAGGCGGGTTGGAGGCTGG + Intergenic
1139623081 16:68163258-68163280 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1139669871 16:68485375-68485397 GACCCTGGCCAGGTGGTGGGTGG - Intergenic
1139686261 16:68605969-68605991 GTCCCAGGTCAGTTGGTGGCTGG - Intergenic
1139887942 16:70224689-70224711 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1140063346 16:71589722-71589744 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1140403518 16:74691572-74691594 GAACCAGAGCTGGTGGTGGCTGG + Intronic
1140994499 16:80244282-80244304 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1141607128 16:85160404-85160426 AACCCAGGCCCGGTGGAGTCAGG + Intergenic
1141728705 16:85808133-85808155 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1141828327 16:86496131-86496153 AACCCAGGCCGGGTGTTCTCTGG + Intergenic
1142061106 16:88029976-88029998 ACCCCAGGCTGGGTGGTGGTTGG + Intronic
1142205276 16:88779925-88779947 CACCCAGGCTGGGTGGGGGTAGG - Intronic
1142299288 16:89247303-89247325 GGCCTAGGCGGGGTGGGGGCAGG + Intergenic
1142332462 16:89463147-89463169 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1142391911 16:89806870-89806892 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1203009919 16_KI270728v1_random:230507-230529 GACCCAGCCTGGGTGGGGGATGG + Intergenic
1203145050 16_KI270728v1_random:1793813-1793835 GACCCAGCCTGGGTGGGGGATGG - Intergenic
1142533522 17:598372-598394 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1142533799 17:599225-599247 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1142634202 17:1247044-1247066 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1142704929 17:1689096-1689118 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1142825556 17:2507600-2507622 CACCCAGACGGGGTGGTGGCCGG - Intronic
1142913052 17:3112358-3112380 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1142949407 17:3465252-3465274 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1142963168 17:3564200-3564222 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1142974195 17:3633741-3633763 TACCCAGACGGGGTGGTGGCCGG - Intronic
1143115230 17:4578328-4578350 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1143206451 17:5143228-5143250 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1143277255 17:5721366-5721388 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1143342845 17:6226552-6226574 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1143462818 17:7114790-7114812 GTCCCAGGCCAGGAGGTGCCAGG - Intronic
1143632827 17:8148608-8148630 GGCCCTGGCCTGGTGGGGGCTGG - Intronic
1143689720 17:8550614-8550636 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1143891507 17:10105986-10106008 GGCCCCGCCTGGGTGGTGGCAGG - Intronic
1144009542 17:11133516-11133538 TAGCCAGGCGTGGTGGTGGCGGG + Intergenic
1144482227 17:15637721-15637743 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1144510139 17:15867845-15867867 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
1144524553 17:15979509-15979531 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1144536573 17:16095799-16095821 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1144559704 17:16311978-16312000 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1144702595 17:17348831-17348853 GGTCCAGGCAGGGTGGTGGTTGG + Intergenic
1144716823 17:17442180-17442202 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1144798905 17:17912175-17912197 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1144860536 17:18298527-18298549 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1144934647 17:18888367-18888389 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1145022387 17:19441882-19441904 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1145027131 17:19476175-19476197 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1145047096 17:19627644-19627666 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1145174296 17:20685563-20685585 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1145206310 17:20985672-20985694 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1145684635 17:26639320-26639342 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1145863195 17:28224752-28224774 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1145895576 17:28455931-28455953 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1145896245 17:28459238-28459260 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1146048783 17:29532866-29532888 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1146157634 17:30536934-30536956 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1146695709 17:34907745-34907767 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1146703908 17:34985847-34985869 GCCCAAGGCTGGCTGGTGGCTGG - Intronic
1146731196 17:35194997-35195019 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1146731386 17:35195598-35195620 TTCCCAGGCGGGGTGGCGGCTGG + Intergenic
1147024271 17:37566108-37566130 TTCCCAGACAGGGTGGTGGCCGG - Intronic
1147109792 17:38253494-38253516 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1147172933 17:38631743-38631765 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1147220953 17:38930527-38930549 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1147278536 17:39338011-39338033 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1147622418 17:41876387-41876409 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1147709143 17:42449505-42449527 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1147963660 17:44181300-44181322 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1147974548 17:44239060-44239082 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1148267470 17:46238099-46238121 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1148404484 17:47398335-47398357 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1148406619 17:47421118-47421140 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1149624825 17:58073787-58073809 CTCCCAGACCGGGTGGTGGCCGG + Intergenic
1149626583 17:58084123-58084145 GTTCCAGGCCGGGTGGGGGAGGG + Intronic
1149633182 17:58142980-58143002 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
1149793753 17:59500623-59500645 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1149909285 17:60552346-60552368 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1149950143 17:60976958-60976980 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1150056394 17:62021209-62021231 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1150214151 17:63457152-63457174 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
1150237255 17:63603085-63603107 TAGCCAGGCGTGGTGGTGGCGGG + Intronic
1150286959 17:63960136-63960158 GACCCAGGGCAGCTGGTGCCTGG - Intronic
1150380653 17:64716824-64716846 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1150477294 17:65484709-65484731 CCCCCAGACGGGGTGGTGGCCGG - Intergenic
1150557849 17:66269445-66269467 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1150612830 17:66747908-66747930 GTTCCAGGCCGGGGGGTGCCGGG + Intronic
1150703926 17:67470676-67470698 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1151758148 17:76086425-76086447 CACCCAGGGTGGGTGGGGGCAGG - Intronic
1151784816 17:76270363-76270385 GATCCAGGGCGCCTGGTGGCTGG - Exonic
1151874614 17:76859996-76860018 TAGCCAGGCCTGGTGGTGCCTGG + Intergenic
1151954622 17:77374126-77374148 GACACAGCCCAGGTCGTGGCAGG + Intronic
1152032493 17:77853050-77853072 GGCCCAGGCCAGGTGCTGACTGG + Intergenic
1152103518 17:78316172-78316194 GACCCAGGCGCGGCCGTGGCTGG - Intergenic
1152129221 17:78465904-78465926 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1152300622 17:79493478-79493500 CAGCCAGGCAGGGAGGTGGCAGG - Intronic
1152430790 17:80247363-80247385 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1152478920 17:80537369-80537391 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1152487174 17:80602088-80602110 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1152612898 17:81324270-81324292 ACCCCAGGCCTGGTGCTGGCAGG + Intronic
1152672793 17:81618678-81618700 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1152710213 17:81867599-81867621 GACCCTGGTGGGGTGGTGGGAGG - Intergenic
1152810035 17:82376938-82376960 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1152854381 17:82655830-82655852 GACCCAGGCTTGGGGGTGTCTGG - Exonic
1153243247 18:3049890-3049912 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1153605293 18:6827208-6827230 CTCCCAGACAGGGTGGTGGCCGG + Intronic
1153634187 18:7098941-7098963 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1153843049 18:9024139-9024161 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1154120438 18:11647833-11647855 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1154265458 18:12874780-12874802 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1154278071 18:12979589-12979611 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1154398100 18:14010478-14010500 CCCCCAGACGGGGTGGTGGCCGG + Intergenic
1154990055 18:21592191-21592213 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1157319063 18:46620342-46620364 AAGCCAGGGAGGGTGGTGGCCGG + Intronic
1157626292 18:49053936-49053958 GACCCAGGATGGGAGGTGGGTGG + Intronic
1157629155 18:49079925-49079947 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1157640051 18:49203327-49203349 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1157677146 18:49577538-49577560 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1157705353 18:49800370-49800392 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1158148884 18:54344047-54344069 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1158459150 18:57632599-57632621 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1158718359 18:59900261-59900283 GACCCAGGCCGGGCGGGGTCGGG + Intronic
1159157992 18:64608848-64608870 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1159324275 18:66894394-66894416 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1159340376 18:67126707-67126729 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1160108363 18:76001385-76001407 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1160182279 18:76645927-76645949 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1160228322 18:77028511-77028533 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1160457109 18:79009108-79009130 GACACAGGCCAGGGAGTGGCGGG - Intergenic
1160691610 19:462894-462916 GACCCAGGGCGAGGGGAGGCCGG - Intergenic
1160703063 19:517636-517658 GACCCAGGCTGGGGGGTGCTGGG + Intronic
1160703174 19:517903-517925 GGCCCAGGCTGGGTAGAGGCTGG + Intronic
1160703191 19:517952-517974 GGCCCAGGCTGGGTAGAGGCTGG + Intronic
1160743341 19:698045-698067 GAGCCGGGCCTGGTGGTGGCAGG - Intergenic
1160882777 19:1329530-1329552 GACACATGCCGGGTCGTGACTGG - Intergenic
1160916436 19:1499134-1499156 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1161035748 19:2083459-2083481 GACCATGGCCTGGAGGTGGCCGG - Intronic
1161373167 19:3925007-3925029 GACCCAGCCGGGGTGGCGGTGGG - Exonic
1161407485 19:4098698-4098720 GACACAGCCCGGGAGGGGGCGGG - Intronic
1161561324 19:4974251-4974273 TACCCGGGCATGGTGGTGGCCGG + Intronic
1161591406 19:5130865-5130887 GACCAAGGCCTGGGGGTGCCTGG + Intronic
1161662273 19:5554211-5554233 GACCAAGGCCCAGTGGTGGCAGG + Intergenic
1161699229 19:5785819-5785841 ATCCCAGGCAGGCTGGTGGCTGG - Intronic
1161790378 19:6355945-6355967 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1161997941 19:7725646-7725668 TAGCCAGGCATGGTGGTGGCGGG + Intergenic
1162145558 19:8610832-8610854 GGCCCAGGCCGGGCGGCGGCAGG - Intergenic
1162279076 19:9680398-9680420 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1162463917 19:10829764-10829786 CACCCAGGCCTGCAGGTGGCAGG + Intronic
1162500322 19:11049757-11049779 GTCGCAGGCAGGCTGGTGGCTGG - Intronic
1162538144 19:11276642-11276664 CACCCAGACGGGGTGGCGGCCGG + Intergenic
1162542064 19:11303030-11303052 CTCCCAGACGGGGTGGTGGCGGG - Intronic
1162695187 19:12468167-12468189 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1162714562 19:12621829-12621851 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1162887137 19:13704000-13704022 CTCCCAGACCGGGCGGTGGCCGG - Intergenic
1163143240 19:15363631-15363653 CTCCCAGACAGGGTGGTGGCTGG - Intronic
1163313812 19:16529644-16529666 GTACCAGGCTGGGTGGTGGGCGG + Exonic
1163501734 19:17680276-17680298 GGCGCAGGCGGGGAGGTGGCGGG - Intronic
1163542466 19:17918964-17918986 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1163558371 19:18005511-18005533 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1163607270 19:18281987-18282009 GGCCCCGGCCGGGCGGGGGCGGG + Intergenic
1163735945 19:18980819-18980841 GAGCCAGGCCTGGTGCAGGCTGG - Intergenic
1163822392 19:19503319-19503341 GCCCCAGGCAGAGTGGTGGGGGG + Intronic
1163896422 19:20064361-20064383 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1163904356 19:20138082-20138104 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1163905559 19:20149294-20149316 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1163906392 19:20152552-20152574 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1163921837 19:20296688-20296710 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1163945131 19:20529603-20529625 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164012228 19:21213025-21213047 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164040151 19:21486846-21486868 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1164043116 19:21511101-21511123 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1164054014 19:21607038-21607060 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164071747 19:21775605-21775627 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1164071890 19:21776123-21776145 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1164081478 19:21865266-21865288 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164081917 19:21866452-21866474 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164105556 19:22106629-22106651 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164186085 19:22871372-22871394 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164238883 19:23366088-23366110 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1164239299 19:23369480-23369502 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1164264040 19:23595182-23595204 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1164298342 19:23936978-23937000 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1164652164 19:29898860-29898882 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1164659400 19:29949494-29949516 TTCCCAGACGGGGTGGTGGCTGG + Intronic
1165192747 19:34079009-34079031 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1165199610 19:34133193-34133215 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1165295318 19:34921952-34921974 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1165481756 19:36068876-36068898 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1165768227 19:38363985-38364007 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1165842490 19:38797648-38797670 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1165852000 19:38855489-38855511 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1166028125 19:40107737-40107759 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1166114835 19:40647888-40647910 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1166191515 19:41179923-41179945 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1166251642 19:41575684-41575706 GACCCAGGCCTGGAGGTCTCGGG - Intronic
1166261825 19:41645331-41645353 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1166343198 19:42150792-42150814 GCCGCAGGCCGGGTGGGGGTGGG + Intronic
1166421296 19:42639324-42639346 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1166425661 19:42676313-42676335 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1166456842 19:42948969-42948991 GCCCCAGCCCGGGTGGAGTCAGG + Intronic
1166466794 19:43039838-43039860 GTCCCAGCCCGGGTGGAGTCAGG + Intronic
1166472931 19:43095916-43095938 GTCCCAGCCCGGGTGGAGTCAGG + Intronic
1166486595 19:43219467-43219489 GCCCCAGCCCGGGTGGAGTCAGG + Intronic
1166640304 19:44489212-44489234 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1166708363 19:44921634-44921656 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
1166832914 19:45648683-45648705 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1167038871 19:47010085-47010107 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
1167074262 19:47239532-47239554 GACCGGGGCCGGGTGGGGGCTGG + Intergenic
1167112681 19:47471512-47471534 GCCCCAGACGGGGTGGGGGCGGG + Intronic
1167269226 19:48498548-48498570 GACCCGGGTCTGGAGGTGGCCGG + Exonic
1167294257 19:48640051-48640073 GACTCAGGGCGGAGGGTGGCGGG + Intronic
1167540993 19:50086804-50086826 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1167548182 19:50141337-50141359 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1167687564 19:50966183-50966205 GAAACAGGCCGGGTGTAGGCAGG - Intronic
1167823782 19:51953121-51953143 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1167897411 19:52593300-52593322 CTCCCAGACAGGGTGGTGGCTGG + Intergenic
1167909546 19:52690550-52690572 GGCCTGGGCCGGGTGGCGGCGGG + Intronic
1167937536 19:52920163-52920185 GTCCCAGACGGGGTCGTGGCCGG - Intergenic
1167975423 19:53222681-53222703 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1167975547 19:53223116-53223138 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1167980251 19:53269908-53269930 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1168017746 19:53587087-53587109 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1168063788 19:53908447-53908469 GACCCGGTCCGGGTGGATGCTGG + Intergenic
1168572768 19:57483690-57483712 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1168630254 19:57950615-57950637 GAAGGAGGCCGGGTGGTGGGAGG - Intergenic
1168658520 19:58147868-58147890 CTCCCAGACGGGGTGGTGGCTGG - Intronic
925053946 2:841053-841075 GAGCCATGCAGGGTGGTGGCTGG + Intergenic
925221408 2:2144276-2144298 GGCCCAGGCGTGGGGGTGGCTGG - Intronic
925305093 2:2842650-2842672 GACCCAGGCAGAGGGGTGTCTGG + Intergenic
925400425 2:3569024-3569046 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
925400581 2:3569580-3569602 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
925969269 2:9095711-9095733 GACAGGGGCAGGGTGGTGGCAGG - Intergenic
926215263 2:10902470-10902492 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
926251007 2:11155425-11155447 GGCCCTGGCCGGGTGGTCCCGGG + Exonic
926674701 2:15611405-15611427 CTCCCAGACGGGGTGGTGGCCGG + Intronic
926683262 2:15680058-15680080 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
926683433 2:15680620-15680642 TTCCCAGACCGGGTGGCGGCCGG + Intergenic
927747474 2:25634530-25634552 CTCCCAGACGGGGTGGTGGCCGG - Intronic
927757753 2:25723145-25723167 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
927833010 2:26370379-26370401 CTCCCAGACGGGGTGGTGGCCGG + Intronic
927978805 2:27359713-27359735 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
928009447 2:27594246-27594268 ATCCCAGACGGGGTGGTGGCCGG + Intronic
928399726 2:30969210-30969232 CACCCGGTCCTGGTGGTGGCAGG - Intronic
928597508 2:32870006-32870028 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
928889018 2:36180634-36180656 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
929061868 2:37932583-37932605 CTCCCAGACGGGGTGGTGGCCGG + Intronic
929066032 2:37977360-37977382 CTCCCAGACGGGGTGGTGGCCGG + Intronic
929110827 2:38403854-38403876 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
929151836 2:38755774-38755796 CTCCCAGACGGGGTGGTGGCCGG + Intronic
929416558 2:41748170-41748192 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
929445203 2:41995652-41995674 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
929447643 2:42014251-42014273 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
929447936 2:42014995-42015017 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
929577691 2:43063038-43063060 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
929614814 2:43298071-43298093 CTCCCAGACGGGGTGGTGGCCGG - Intronic
930079052 2:47432935-47432957 CTCCCAGACGGGGTGGTGGCCGG + Intronic
930208697 2:48614355-48614377 CTCCCAGACGGGGTGGTGGCCGG + Intronic
930396247 2:50828126-50828148 CTCCCAGACGGGGTGGTGGCCGG + Intronic
930665292 2:54095405-54095427 CTCCCAGACGGGGTGGTGGCCGG + Intronic
930704036 2:54486194-54486216 CTCCCAGACAGGGTGGTGGCCGG - Intronic
930821584 2:55651248-55651270 CTCCCAGACGGGGTGGTGGCCGG - Intronic
930833755 2:55773455-55773477 CTCCCAGACTGGGTGGTGGCCGG + Intergenic
930834049 2:55774326-55774348 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
931584348 2:63809385-63809407 CTCCCAGACGGGGTGGTGGCTGG - Intronic
931604787 2:64041850-64041872 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
931655913 2:64511469-64511491 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
931752152 2:65339199-65339221 CTCCCAGACGGGGTGGTGGCTGG - Intronic
932367394 2:71161553-71161575 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
932418841 2:71589537-71589559 CCCCCAGGCCTGGGGGTGGCAGG - Intronic
932621221 2:73265786-73265808 GACCCAGGGAGGGTAGGGGCAGG + Intronic
932710561 2:74061035-74061057 CTCCCAGACGGGGTGGTGGCCGG + Intronic
932718847 2:74123668-74123690 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
932807278 2:74795609-74795631 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
932815233 2:74855970-74855992 GGCCCATGACGGGTGGTGGGTGG + Intronic
933735248 2:85488525-85488547 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
934549148 2:95243816-95243838 CTCCCAGACGGGGTGGTGGCCGG - Intronic
934562492 2:95320500-95320522 GAGACAGGCCGAGGGGTGGCAGG - Intronic
934657087 2:96122055-96122077 GCCCCAGCCTGGGTGGTGGGAGG - Intergenic
934703357 2:96461203-96461225 TTCCCAGACCGGGTGGCGGCCGG - Intergenic
934703875 2:96462575-96462597 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
934749600 2:96784800-96784822 CACCCAGACAGGTTGGTGGCAGG + Intronic
934752962 2:96805968-96805990 CTCCCAGACGGGGTGGTGGCCGG + Intronic
934987591 2:98899122-98899144 CACCAAGGCAGGGTGGTGGCAGG + Intronic
935339633 2:102048327-102048349 TACCGAGGCCTGTTGGTGGCGGG + Intergenic
935874530 2:107492490-107492512 AACACAGGCAGGGTGGTGCCTGG + Intergenic
935991957 2:108727154-108727176 CTCCCAGACGGGGTGGTGGCCGG + Intronic
936504683 2:113096381-113096403 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
936546625 2:113395478-113395500 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
937124049 2:119462022-119462044 AACCCAGGCCGGGTGGCAGTGGG + Intronic
937168362 2:119843510-119843532 CTCCCAGACGGGGTGGTGGCCGG + Intronic
937919324 2:127119421-127119443 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
937919668 2:127120423-127120445 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
937947581 2:127353716-127353738 CTCCCAGACGGGGTGGTGGCCGG - Intronic
938005520 2:127787378-127787400 CTCCCAGACGGGGTGGTGGCCGG + Intronic
938248629 2:129797312-129797334 GACCCAGGGCGGGTGGCAGCTGG - Intergenic
938250095 2:129808069-129808091 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
938253463 2:129833787-129833809 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
938463486 2:131512364-131512386 GATGAAGGCCGGGTGCTGGCTGG - Intergenic
938720770 2:134064441-134064463 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
938821883 2:134968380-134968402 CTCCCAGACGGGGTGGTGGCCGG + Intronic
938828759 2:135033134-135033156 CTCCCAGACGGGGTGGTGGCCGG + Intronic
938891151 2:135706898-135706920 CTCCCAGACGGGGTGGTGGCCGG + Intronic
939186942 2:138872226-138872248 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
939477336 2:142702773-142702795 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
940269481 2:151875514-151875536 CTCCCAGACGGGGTGGTGGCCGG + Intronic
940299343 2:152160971-152160993 CTCCCAGACGGGGTGGTGGCCGG - Intronic
940455313 2:153890715-153890737 GACTCATGCTGTGTGGTGGCTGG + Intronic
940635651 2:156293789-156293811 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
940652160 2:156451184-156451206 CTCCCAGACGGGGTGGTGGCCGG + Intronic
940817374 2:158311056-158311078 TTCCTAGGCGGGGTGGTGGCCGG + Intronic
941023813 2:160438780-160438802 CTCCCAGACGGGGTGGTGGCCGG + Intronic
941602815 2:167563170-167563192 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
941768636 2:169326627-169326649 TTCCCAGACGGGGTGGTGGCCGG - Intronic
941786843 2:169506275-169506297 CTCCCAGACGGGGTGGTGGCCGG - Exonic
941793170 2:169575031-169575053 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
941814373 2:169785547-169785569 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
941838743 2:170055280-170055302 CACCCAGGCAGTGTGGTGCCTGG - Intronic
941847959 2:170150378-170150400 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
942020815 2:171866353-171866375 CTCCCAGACGGGGTGGTGGCCGG + Intronic
942024870 2:171900430-171900452 CTCCCAGACGGGGTGGTGGCCGG - Intronic
942098608 2:172556409-172556431 GCCCCAGGCCGGGTCGGCGCCGG + Intronic
942620966 2:177845059-177845081 CTCCCAGACGGGGTGGTGGCCGG + Intronic
942630860 2:177947240-177947262 CTCCCAGACGGGGTGGTGGCCGG - Intronic
943005881 2:182386893-182386915 CTCCCAGACCGGGTGGTGGCCGG - Intronic
943125855 2:183792662-183792684 ATCCCACACCGGGTGGTGGCTGG + Intergenic
943297042 2:186153851-186153873 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
943323709 2:186473669-186473691 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
943411629 2:187556311-187556333 TTCCCAGGCGGGGTGGCGGCCGG - Intronic
943412002 2:187557384-187557406 CTCCCAGACGGGGTGGTGGCCGG - Intronic
943418607 2:187637727-187637749 TTCCCAGACGGGGTGGTGGCTGG + Intergenic
943773777 2:191742884-191742906 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
944255465 2:197619216-197619238 CTCCCAGACGGGGTGGTGGCCGG - Intronic
944262874 2:197695952-197695974 CTCCCAGACGGGGTGGTGGCCGG + Intronic
944283223 2:197922533-197922555 CTCCCAGACGGGGTGGTGGCCGG + Intronic
944532717 2:200683147-200683169 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
944572911 2:201062500-201062522 TAGCCAGGCGTGGTGGTGGCGGG + Intronic
944593405 2:201239288-201239310 CTCCCAGACGGGGTGGTGGCCGG + Intronic
944625189 2:201563036-201563058 CTCCCAGACGGGGTGGTGGCCGG + Intronic
944715979 2:202376443-202376465 GACCGAGGGCGGGGGGCGGCGGG - Intergenic
944732842 2:202534781-202534803 CTCCCAGACGGGGTGGTGGCCGG + Intronic
944751466 2:202715053-202715075 CTCCCAGACGGGGTGGTGGCGGG + Intronic
944798019 2:203207385-203207407 CTCCCAGACGGGGTGGTGGCCGG - Intronic
944815487 2:203372449-203372471 CTCCCAGACGGGGTGGTGGCCGG + Intronic
945090243 2:206171484-206171506 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
945110253 2:206356070-206356092 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
945114770 2:206400530-206400552 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
945316566 2:208377392-208377414 CTCCCAGACGGGGTGGTGGCCGG + Intronic
945530884 2:210951063-210951085 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
946241140 2:218356854-218356876 GACACAGACCGGGTAGAGGCAGG + Exonic
946304337 2:218847051-218847073 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
946318331 2:218932074-218932096 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
946651051 2:221892506-221892528 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
946742890 2:222817066-222817088 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
947402632 2:229743611-229743633 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
947901248 2:233724051-233724073 CTCCCAGACGGGGTGGTGGCCGG + Intronic
948492227 2:238320849-238320871 GGCCCGGGCCGGGTGGCGCCGGG + Intronic
948499723 2:238383019-238383041 GAGACAGGCAGGGAGGTGGCTGG - Intronic
948651597 2:239449449-239449471 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
948858148 2:240740208-240740230 GACACAGGCAGGGTAGGGGCAGG + Intronic
949048719 2:241885398-241885420 GCCCCAGGTGGGGAGGTGGCAGG + Intergenic
1168747644 20:257913-257935 GAGCCAGGTTGGGTGGAGGCAGG + Intronic
1169108629 20:3018745-3018767 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1169167961 20:3440953-3440975 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1169371028 20:5028127-5028149 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1169718192 20:8644206-8644228 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1170202644 20:13760854-13760876 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1170384443 20:15800662-15800684 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1170622886 20:18010110-18010132 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1170677375 20:18495061-18495083 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1170811424 20:19678228-19678250 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1171497011 20:25562268-25562290 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1171848335 20:30291503-30291525 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1171951968 20:31427894-31427916 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1171956790 20:31469969-31469991 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1172051339 20:32121723-32121745 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1172059583 20:32177395-32177417 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1172141378 20:32724414-32724436 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1172199692 20:33115934-33115956 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1172208020 20:33178255-33178277 GATCCAGGCCTGGTGGGGGCAGG + Intronic
1172209053 20:33185033-33185055 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1172257932 20:33536190-33536212 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1172273552 20:33667793-33667815 GAAACTGGCCGGATGGTGGCGGG - Exonic
1172279687 20:33700180-33700202 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1172348660 20:34223692-34223714 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1172349199 20:34229105-34229127 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1172465935 20:35154521-35154543 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1172574908 20:36001258-36001280 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1172717492 20:36976248-36976270 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1172721375 20:37001234-37001256 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1172722961 20:37013061-37013083 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1172729009 20:37069943-37069965 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1172736071 20:37126608-37126630 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1172918323 20:38461166-38461188 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1173472326 20:43333331-43333353 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1173488383 20:43458171-43458193 GTCCCAGGCCTGGTGGCGGCGGG + Intronic
1173517869 20:43677778-43677800 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1174020419 20:47525454-47525476 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1174345004 20:49922593-49922615 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1175379040 20:58549991-58550013 GCCCCTGGCTGGGTGATGGCGGG - Intergenic
1175439636 20:58981533-58981555 GACCCCGGGCGGGCGGGGGCGGG - Intronic
1175486454 20:59350269-59350291 CACAGAAGCCGGGTGGTGGCGGG + Intergenic
1175521269 20:59604126-59604148 GGCCCAGGCCAGGTGGTTGCGGG + Intronic
1175962929 20:62646201-62646223 GAGGCAGGGCGGGTGGTGGGAGG - Intronic
1176070653 20:63224610-63224632 GGCCCAGGCCTGTTGGGGGCAGG - Intergenic
1176089201 20:63311542-63311564 GAGCTGGGCCGGGGGGTGGCGGG + Intronic
1176095595 20:63342804-63342826 GACCTCGGGCGGGTCGTGGCCGG + Intergenic
1176348152 21:5770327-5770349 CTCCCAGACGGGGTGGTGGCAGG + Intergenic
1176354966 21:5890911-5890933 CTCCCAGACGGGGTGGTGGCAGG + Intergenic
1176496675 21:7554128-7554150 CTCCCAGACGGGGTGGTGGCAGG - Intergenic
1176542473 21:8168397-8168419 CTCCCAGACGGGGTGGTGGCAGG + Intergenic
1176561424 21:8351442-8351464 CTCCCAGACGGGGTGGTGGCAGG + Intergenic
1176852831 21:13935589-13935611 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1177134087 21:17292031-17292053 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1177177876 21:17719165-17719187 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1178075860 21:29012246-29012268 CACCCAGACCGGGTGGTGGCCGG - Intronic
1178812729 21:35898082-35898104 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1179729839 21:43361551-43361573 GACAGAGGCAGCGTGGTGGCCGG + Intergenic
1179794913 21:43776874-43776896 GCTCCAGGCTGGGTGGGGGCAGG + Intergenic
1179969396 21:44825409-44825431 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1180039695 21:45269261-45269283 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1180125248 21:45785607-45785629 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1180212220 21:46301878-46301900 TAGCCACTCCGGGTGGTGGCAGG + Exonic
1180672163 22:17561504-17561526 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1180829945 22:18900218-18900240 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1180861197 22:19084131-19084153 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1180929595 22:19579888-19579910 GAAACAGGCCGTGTGGTGGTGGG - Intergenic
1181439878 22:22930286-22930308 GACCCAGGCCTGGCCGTGCCTGG + Intergenic
1181538560 22:23560998-23561020 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1181657630 22:24316799-24316821 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1181764601 22:25082199-25082221 GGCCCAGAGGGGGTGGTGGCTGG - Intronic
1181789874 22:25256813-25256835 TAGCCAGGCGTGGTGGTGGCGGG - Intergenic
1181792250 22:25277654-25277676 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1181981853 22:26772669-26772691 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1182343498 22:29643811-29643833 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1182377217 22:29857770-29857792 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1182428965 22:30289228-30289250 CCCCCAGGCCGGATGGCGGCCGG + Intronic
1182484484 22:30631524-30631546 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
1182523998 22:30904152-30904174 GACCCTTGCAGGGTGATGGCAGG + Intronic
1182616094 22:31591488-31591510 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1183302773 22:37066418-37066440 GTCCCAGGCTGGCTGGAGGCCGG - Intronic
1183313124 22:37122300-37122322 GACGCAGGTCGGGTAGTGGAGGG - Intergenic
1183343347 22:37294144-37294166 GAGGCAGGCAGGGTGGAGGCGGG + Intronic
1183595597 22:38808012-38808034 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1183821612 22:40350765-40350787 TAGCCAGGCGGCGTGGTGGCAGG - Intronic
1183840964 22:40500914-40500936 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1183845699 22:40538041-40538063 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1183941094 22:41295172-41295194 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1183995593 22:41630983-41631005 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1184145548 22:42607994-42608016 TTCCCAGACGGGGTGGTGGCTGG - Intronic
1184169425 22:42750472-42750494 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1184175415 22:42786153-42786175 GCCCCAGGAAGGGTGGAGGCAGG - Intergenic
1184409516 22:44318451-44318473 GGCCCAGGCCTGGCGGAGGCTGG + Intergenic
1184849598 22:47112660-47112682 AACCCAGCCCGGGTGTTCGCAGG + Intronic
1185344185 22:50304243-50304265 GCCCCAGGCCCAGTGGTGCCGGG - Intronic
1185346568 22:50313207-50313229 GTGCCAGGCAGGGTGGGGGCTGG - Intronic
1203247412 22_KI270733v1_random:84815-84837 CTCCCAGACGGGGTGGTGGCAGG + Intergenic
1203280036 22_KI270734v1_random:125489-125511 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
949569915 3:5283743-5283765 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
949853646 3:8440696-8440718 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
949992718 3:9592218-9592240 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
950044225 3:9939853-9939875 CTCCCAGACGGGGTGGTGGCCGG + Intronic
950044341 3:9940252-9940274 TTCCCAGACGGGGTGGTGGCCGG + Intronic
950060965 3:10070602-10070624 CTCCCAGACGGGGTGGTGGCCGG - Intronic
950193411 3:10993017-10993039 GAGCCGGGCCGGGTGGGGGGCGG + Intronic
950253553 3:11487355-11487377 CTCCCAGACGGGGTGGTGGCCGG + Intronic
950362902 3:12462383-12462405 TCCCCAGCCCCGGTGGTGGCAGG - Intergenic
950412643 3:12849548-12849570 CTCCCAGACGGGGTGGTGGCCGG + Intronic
950551726 3:13670132-13670154 GACCCCAGCGGGGTGGTGGAAGG - Intergenic
950660316 3:14463171-14463193 GATCCAGGCCAGCTGGTGTCAGG - Intronic
950742307 3:15061627-15061649 TTCCCAGACGGGGTGGTGGCCGG - Intronic
950754578 3:15162552-15162574 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
950819643 3:15742849-15742871 CTCCCAGACGGGGTGGTGGCTGG - Intronic
950948981 3:16979858-16979880 CTCCCAGACGGGGTGGTGGCCGG + Intronic
951013185 3:17704442-17704464 CTCCCAGACGGGGTGGTGGCCGG + Intronic
951290346 3:20866678-20866700 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
951550391 3:23871198-23871220 CTCCCAGACGGGGTGGTGGCCGG + Intronic
952308977 3:32170072-32170094 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
952364755 3:32664358-32664380 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
952896291 3:38081336-38081358 CTCCCAGACGGGGTGGTGGCCGG + Intronic
953037886 3:39228070-39228092 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
953084216 3:39651561-39651583 TTCCCAGACGGGGTGGTGGCTGG + Intergenic
953257838 3:41306620-41306642 CTCCCAGACGGGGTGGTGGCCGG - Intronic
953307027 3:41840901-41840923 ATCCCAGACAGGGTGGTGGCAGG - Intronic
953426440 3:42798761-42798783 CTCCCAGACGGGGTGGTGGCCGG - Intronic
953472223 3:43177215-43177237 GACCTAGGCCATGTGATGGCCGG + Intergenic
953652560 3:44820871-44820893 CTCCCAGACGGGGTGGTGGCCGG + Intronic
953855299 3:46495155-46495177 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
953959579 3:47256616-47256638 CTCCCAGACGGGGTGGTGGCCGG - Intronic
954048441 3:47952361-47952383 CTCCCAGACTGGGTGGTGGCCGG - Intronic
954059769 3:48057083-48057105 CTCCCAGACGGGGTGGTGGCCGG - Intronic
954081173 3:48212553-48212575 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
954118894 3:48483609-48483631 CTCCCAGACGGGGTGGTGGCCGG + Intronic
954162993 3:48734911-48734933 CTCCCAGACGGGGTGGTGGCCGG - Intronic
954355897 3:50084167-50084189 CTCCCAGACAGGGTGGTGGCCGG + Intronic
954399150 3:50311121-50311143 CTCCCAGACGGGGTGGTGGCCGG + Intronic
954425796 3:50442470-50442492 GACCCAGGCCTTGGGGTGGGTGG + Intronic
954450544 3:50569178-50569200 GAACCAGGCCGGGAGGTGTGTGG - Exonic
954483455 3:50823686-50823708 CTCCCAGACGGGGTGGTGGCCGG + Intronic
954523657 3:51249748-51249770 CTCCCAGACGGGGTGGTGGCCGG - Intronic
954529754 3:51308739-51308761 CTCCCAGACGGGGTGGTGGCCGG + Intronic
955173130 3:56584676-56584698 TTCCCAGGCAGGGTGGCGGCCGG + Intronic
955256621 3:57338584-57338606 ATCCCAGACGGGGTGGTGGCCGG - Intronic
955362767 3:58289756-58289778 CTCCCAGACGGGGTGGTGGCTGG + Intronic
955394610 3:58549591-58549613 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
955434709 3:58890073-58890095 CTCCCAGACGGGGTGGTGGCCGG + Intronic
955674296 3:61434314-61434336 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
956270846 3:67445092-67445114 CTCCCAGACGGGGTGGTGGCCGG - Intronic
956697252 3:71929019-71929041 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
957035635 3:75289936-75289958 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
957203450 3:77165035-77165057 CTCCCAGACGGGGTGGTGGCCGG - Intronic
957629054 3:82695050-82695072 TAGCCAGGCATGGTGGTGGCTGG + Intergenic
957855376 3:85869805-85869827 TAGCCAGGCCCCGTGGTGGCGGG - Intronic
958406936 3:93763614-93763636 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
959042921 3:101440045-101440067 CTCCCAGACGGGGTGGTGGCCGG - Intronic
959054172 3:101551757-101551779 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
959221877 3:103531432-103531454 CTCCCAGACCGAGTGGTGGCTGG + Intergenic
959419012 3:106111053-106111075 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
959586031 3:108026186-108026208 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
959683947 3:109124603-109124625 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
959984354 3:112556499-112556521 CTCCCAGACGGGGTGGTGGCCGG - Intronic
960526562 3:118718270-118718292 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
960577626 3:119243004-119243026 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
960698045 3:120414464-120414486 CTCCCAGACGGGGTGGTGGCCGG - Intronic
960782039 3:121330450-121330472 GAGCAAAGCCAGGTGGTGGCTGG - Intronic
960862369 3:122165377-122165399 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
960866018 3:122201521-122201543 CTCCCAGACGGGGTGGTGGCTGG + Intronic
960874975 3:122287041-122287063 GGCGCAGGCTGGGTGGGGGCCGG - Intergenic
960955319 3:123027222-123027244 GACCCAAGCTGGCTGGCGGCGGG + Intronic
961120084 3:124366725-124366747 CTCCCAGACGGGGTGGTGGCCGG + Intronic
961163611 3:124749914-124749936 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
961351460 3:126307237-126307259 GACCCAGGAAGGGTGCTGGGTGG - Intergenic
961380896 3:126496010-126496032 GGCCCAGGCCTGGGGGAGGCTGG - Intronic
961450835 3:127001623-127001645 GACACAGACTGGGTGGAGGCTGG - Intronic
961704332 3:128773001-128773023 TTCCCAGACGGGGTGGTGGCCGG - Intronic
961704512 3:128773565-128773587 CTCCCAGACGGGGTGGTGGCCGG - Intronic
961705717 3:128783497-128783519 GAGACAAGCCGTGTGGTGGCTGG + Intronic
961729745 3:128955648-128955670 CTCCCAGACGGGGTGGTGGCTGG - Intronic
961784066 3:129338980-129339002 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
961962748 3:130868899-130868921 CTCCCAGACGGGGTGGTGGCCGG - Intronic
962063334 3:131952715-131952737 CTCCCAGACGGGGTGGTGGCCGG - Intronic
962112667 3:132470507-132470529 CTCCCAGACGGGGTGGTGGCCGG + Intronic
962245305 3:133785686-133785708 CTCCCAGACCGGGTGGTGGCTGG - Intronic
962572422 3:136724076-136724098 CTCCCAGACGGGGTGGTGGCCGG - Intronic
963244352 3:143046839-143046861 CTCCCAGACGGGGTGGTGGCCGG + Intronic
963247156 3:143073851-143073873 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
963248820 3:143086136-143086158 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
963451099 3:145482772-145482794 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
963770392 3:149380873-149380895 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
964765871 3:160178483-160178505 GTCCCAGACGGGGTGGCGGCCGG - Intergenic
964766063 3:160179056-160179078 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
966206667 3:177412883-177412905 CACCCAGTCCGGGAGGTGGGGGG - Intergenic
966253377 3:177891599-177891621 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
966360255 3:179121554-179121576 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
966375323 3:179290818-179290840 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
967169257 3:186811389-186811411 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
967177707 3:186874536-186874558 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
967178657 3:186884821-186884843 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
967524351 3:190473673-190473695 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
968139536 3:196244566-196244588 CTCCCAGACGGGGTGGTGGCCGG - Intronic
968175127 3:196543103-196543125 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
968201733 3:196761677-196761699 CTCCCAGACGGGGTGGTGGCCGG + Intronic
968299473 3:197602256-197602278 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
968316672 3:197731515-197731537 CTCCCAGACGGGGTGGTGGCTGG + Intronic
968411856 4:396244-396266 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
968436392 4:592414-592436 TTCCCAGACAGGGTGGTGGCCGG - Intergenic
968666942 4:1827809-1827831 CTCCCAGACGGGGTGGTGGCCGG + Intronic
968825762 4:2895563-2895585 GACCCAGGCTGGATTGTGACGGG + Intronic
968850588 4:3075041-3075063 CAGCCGGGCCGGGTGGCGGCGGG - Exonic
968924067 4:3538369-3538391 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
968983877 4:3865140-3865162 GGCCCAGGCAGGGAGGTGGGAGG - Intergenic
969115374 4:4867607-4867629 GAGGCAGGCGGGGTGGAGGCAGG - Intergenic
969374856 4:6756132-6756154 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
969404271 4:6978214-6978236 CTCCCAGACGGGGTGGTGGCCGG - Intronic
969448199 4:7257358-7257380 GACCCAGGCCTGGGGGTGGTGGG + Intronic
969630025 4:8330567-8330589 GGCCCAGGCCGTGTGGGGACGGG + Intergenic
969784833 4:9448468-9448490 TAGCCAGGCATGGTGGTGGCTGG - Intronic
969871551 4:10107852-10107874 GAACCAGGCCCTGTGTTGGCAGG - Intronic
970215979 4:13760990-13761012 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
970472529 4:16393052-16393074 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
971773287 4:30927330-30927352 CTCCCAGACGGGGTGGTGGCCGG - Intronic
971819957 4:31539251-31539273 GACCCAGGCAGGGTTGGGCCAGG + Intergenic
972288503 4:37669506-37669528 CTCCCAGACAGGGTGGTGGCCGG - Intronic
972304818 4:37820763-37820785 CTCCCAGACGGGGTGGTGGCAGG - Intergenic
972552519 4:40147433-40147455 CTCCCAGACGGGGTGGTGGCCGG + Intronic
972654238 4:41049607-41049629 CTCCCAGACGGGGTGGTGGCCGG - Intronic
972700617 4:41491073-41491095 TTCCCAGACAGGGTGGTGGCCGG + Intronic
973021170 4:45207509-45207531 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
973109341 4:46378132-46378154 CTCCCAGACGGGGTGGTGGCCGG - Intronic
973274301 4:48292182-48292204 TTCCCAGACCGGGTGGCGGCCGG - Intergenic
973281184 4:48363282-48363304 CTCCCAGACGGGGTGGTGGCCGG + Intronic
973593913 4:52466060-52466082 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
973672656 4:53237360-53237382 CTCCCAGACGGGGTGGTGGCCGG + Intronic
973675072 4:53255733-53255755 CTCCCAGACGGGGTGGTGGCCGG + Intronic
974076700 4:57173561-57173583 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
974588819 4:63918466-63918488 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
975042594 4:69762461-69762483 CTCCCAGACGGGGTGGTGGCCGG - Intronic
975793788 4:77984348-77984370 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
975848537 4:78548525-78548547 CTCCCAGACAGGGTGGTGGCTGG - Intergenic
975908785 4:79245386-79245408 TTCCCAGACTGGGTGGTGGCTGG - Intronic
976149337 4:82077529-82077551 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
976226333 4:82798067-82798089 GACCGCGGCGGGGTGGGGGCGGG + Intronic
976264987 4:83181888-83181910 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
976340668 4:83943350-83943372 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
976704627 4:88007806-88007828 GACCCGGGCCGGCTGATGGCTGG + Exonic
976976066 4:91167942-91167964 TTCCCAGACGGGGTGGTGGCCGG - Intronic
977205208 4:94158320-94158342 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
977542136 4:98330497-98330519 CTCCCAGACGGGGTGGTGGCCGG + Intronic
978518810 4:109597253-109597275 CTCCCAGACAGGGTGGTGGCCGG + Intronic
978519747 4:109603626-109603648 TTCCCAGACGGGGTGGTGGCCGG - Intronic
978519759 4:109603666-109603688 TTCCCAGACGGGGTGGTGGCCGG - Intronic
978820151 4:112957535-112957557 CTCCCAGACGGGGTGGTGGCCGG + Intronic
978947609 4:114516876-114516898 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
979240900 4:118446171-118446193 GGGCCAGGCTGGGTGGGGGCGGG - Intergenic
979248343 4:118535425-118535447 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
979482839 4:121238546-121238568 TTCCCAGGCGGGGTGGTGGCCGG - Intergenic
979622641 4:122812668-122812690 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
980056315 4:128083337-128083359 CTCCCAGACGGGGTGGTGGCCGG + Intronic
980895069 4:138853881-138853903 TTCCCAGACGGGGTGGTGGCTGG - Intergenic
980895356 4:138854739-138854761 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
981677617 4:147358384-147358406 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
981970863 4:150660542-150660564 CTCCCAGACCGGGTGGTGGCTGG - Intronic
982022060 4:151214389-151214411 CTCCCAGACGGGGTGGTGGCCGG + Intronic
982026009 4:151254842-151254864 CTCCCAGACGGGGTGGTGGCCGG + Intronic
982053437 4:151526278-151526300 CTCCCAGACGGGGTGGTGGCCGG + Intronic
982191938 4:152866389-152866411 CTCCCAGACGGGGTGGTGGCTGG + Intronic
982709536 4:158746306-158746328 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
982784834 4:159524748-159524770 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
983190260 4:164747271-164747293 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
983217976 4:165019730-165019752 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
983652442 4:170047038-170047060 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
984004679 4:174294564-174294586 CTCCCAGACGGGGTGGTGGCTGG + Intronic
984037853 4:174692035-174692057 CTCCCAGACGGGGTGGTGGCCGG - Intronic
984533705 4:180945410-180945432 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
984632356 4:182074302-182074324 GTCCCAGGCAGGGTAGTGGGAGG + Intergenic
985216438 4:187658339-187658361 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
985247283 4:187991453-187991475 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
985255708 4:188068197-188068219 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
985579933 5:691297-691319 GACCAAGGCCGGGAAGGGGCAGG - Intronic
985594780 5:783356-783378 GACCAAGGCCGGGAAGGGGCAGG - Intergenic
985736677 5:1586777-1586799 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
986887335 5:12256070-12256092 GACCAAGGCTGGGAGGAGGCTGG + Intergenic
987267845 5:16276699-16276721 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
988342137 5:29986356-29986378 GAGCCAGGCCTGGTGGTGGGTGG + Intergenic
988544547 5:32142924-32142946 CTCCCAGACGGGGTGGTGGCCGG - Intronic
988552440 5:32209109-32209131 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
988760088 5:34305535-34305557 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
989021343 5:37012986-37013008 TTCCCAGACGGGGTGGTGGCCGG + Intronic
989061396 5:37415302-37415324 CTCCCAGACGGGGTGGTGGCCGG + Intronic
989068087 5:37483621-37483643 CTCCCAGACAGGGTGGTGGCCGG + Intronic
989075678 5:37562968-37562990 CTCCCAGACGGGGTGGTGGCCGG + Intronic
989211234 5:38861639-38861661 CTCCCAGACGGGGTGGTGGCCGG + Intronic
989247779 5:39273116-39273138 CTCCCAGACGGGGTGGTGGCCGG - Intronic
989575132 5:42980849-42980871 ATCCCAGACGGGGTGGTGGCCGG - Intergenic
989634971 5:43522552-43522574 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
989640368 5:43578133-43578155 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
989648730 5:43665749-43665771 CTCCCAGACGGGGTGGTGGCCGG + Intronic
989663490 5:43824678-43824700 CTCCCAGACGGGGTGGTGGCAGG + Intergenic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
990426594 5:55695788-55695810 CTCCCAGACGGGGTGGTGGCCGG + Intronic
990459188 5:56015557-56015579 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
991073524 5:62513105-62513127 CTCCCAGACGGGGTGGTGGCCGG + Intronic
991127319 5:63083736-63083758 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
991373443 5:65940790-65940812 TTCCCAGACGGGGTGGTGGCTGG - Intronic
991723388 5:69515045-69515067 CTCCCAGACGGGGTGGTGGCTGG + Intronic
991909940 5:71551630-71551652 CTCCCAGACGGGGTGGTGGCCGG + Intronic
992290159 5:75271630-75271652 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
992374251 5:76172520-76172542 CTCCCAGACGGGGTGGTGGCCGG - Intronic
992391584 5:76335942-76335964 CTCCCAGACAGGGTGGTGGCTGG + Intronic
992443286 5:76813142-76813164 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
992463462 5:76984364-76984386 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
992469470 5:77042331-77042353 CTCCCAGACGGGGTGGTGGCCGG + Intronic
992544169 5:77794831-77794853 CTCCCAGACGGGGTGGTGGCCGG + Intronic
992574883 5:78097752-78097774 CTCCCAGACGGGGTGGTGGCCGG - Intronic
992600109 5:78391173-78391195 CTCCCAGACGGGGTGGTGGCCGG + Intronic
992635040 5:78718860-78718882 GACCCAGGCCTGGTGGGCCCTGG + Intronic
992864525 5:80943856-80943878 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
992978468 5:82140697-82140719 CTCCCAGACGGGGTGGTGGCCGG - Intronic
993162637 5:84312080-84312102 CTCCCAGACGGGGTGGTGGCTGG + Intronic
993491603 5:88558313-88558335 GACCCACCCCGGGTGGAGGGGGG + Intergenic
993496729 5:88616289-88616311 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
993657461 5:90595005-90595027 CTCCCAGACGGGGTGGTGGCCGG + Intronic
994053997 5:95394764-95394786 GACCCAGCCCTGTTGGTGGTGGG - Intronic
995052177 5:107719357-107719379 GACCGAGTTCGGGTGGTGGGGGG + Intergenic
995123436 5:108558896-108558918 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
995193983 5:109342980-109343002 CTCCCAGACGGGGTGGTGGCCGG - Intronic
995516079 5:112955266-112955288 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
995709930 5:115025068-115025090 AACCCAGGCAGGGTGTTGGCTGG - Intergenic
995772853 5:115690718-115690740 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
995895009 5:117002285-117002307 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
995942155 5:117599498-117599520 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
995994583 5:118283015-118283037 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
996054037 5:118964851-118964873 TTCCCAGACGGGGTGGTGGCCGG - Intronic
996069769 5:119121802-119121824 CTCCCAGACGGGGTGGTGGCCGG + Intronic
997321547 5:132982913-132982935 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
997336050 5:133109248-133109270 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
997521645 5:134527262-134527284 CACCCAGGCGGGGAGGAGGCGGG - Intronic
997565174 5:134881708-134881730 CTCCCAGACGGGGTGGTGGCCGG + Intronic
997930945 5:138070818-138070840 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
998053788 5:139056791-139056813 CTCCCAGACGGGGTGGTGGCCGG - Intronic
998060150 5:139112772-139112794 CTCCCAGACGGGGTGGTGGCCGG - Intronic
998074504 5:139224763-139224785 CTCCCAGACGGGGTGGTGGCCGG - Intronic
998130910 5:139650610-139650632 GCCCCAGGCCGCGGGGTGGGGGG + Intronic
998239139 5:140427037-140427059 CTCCCAGACGGGGTGGTGGCCGG + Intronic
998431580 5:142075170-142075192 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
998471377 5:142386520-142386542 GACCCACGTGGGGTGGGGGCAGG + Intergenic
999180891 5:149670039-149670061 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
999580875 5:153036757-153036779 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
999603814 5:153296095-153296117 CTCCCAGACAGGGTGGTGGCTGG + Intergenic
1000033112 5:157420104-157420126 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1000042170 5:157492995-157493017 GACCCAGGGCTGGTGATGACTGG - Exonic
1000159516 5:158583455-158583477 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1001252094 5:170154316-170154338 CACCCAGGCCTGGTGGTCTCAGG - Intergenic
1001366662 5:171147863-171147885 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1001393904 5:171403527-171403549 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1001444292 5:171771183-171771205 TAGCCAGGCGTGGTGGTGGCAGG + Intergenic
1001509685 5:172311201-172311223 GGCCAAGGGCGGGGGGTGGCAGG + Intergenic
1001529987 5:172454679-172454701 GACAAAGGCCGGGCGGGGGCCGG - Intergenic
1001985637 5:176072836-176072858 GTCCCAGGCCAGGTGTTGACAGG + Intronic
1002031689 5:176434289-176434311 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1002059694 5:176619245-176619267 GAGCCAGTCCGGGTGGGGGCGGG + Intergenic
1002116269 5:176962621-176962643 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1002231234 5:177765288-177765310 GTCCCAGGCCAGGTGTTGACAGG - Intronic
1002264103 5:178018460-178018482 GTCCCAGGCCAGGTGTTGACAGG + Intronic
1002341306 5:178518417-178518439 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1002529376 5:179834924-179834946 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1002597252 5:180332219-180332241 GATCCTGGCGGGGAGGTGGCGGG + Intronic
1002605577 5:180381060-180381082 GGCCCAGGGTGGGTGGAGGCTGG - Intergenic
1002658249 5:180771196-180771218 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1003290976 6:4777217-4777239 GCCCCTGGTCGGGGGGTGGCGGG + Intronic
1003407234 6:5835403-5835425 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1004388549 6:15190044-15190066 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1004448647 6:15726078-15726100 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1004664052 6:17735190-17735212 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1004874814 6:19940625-19940647 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1005063226 6:21796651-21796673 CTCCCAGACAGGGTGGTGGCTGG + Intergenic
1005159090 6:22837353-22837375 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1005606608 6:27484622-27484644 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1005865517 6:29933214-29933236 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1005929904 6:30475459-30475481 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1005959208 6:30684266-30684288 GAGCGAGGAAGGGTGGTGGCAGG + Intronic
1006030006 6:31171490-31171512 CACCCAGGCTGCGGGGTGGCTGG - Intronic
1006040047 6:31244776-31244798 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1006065185 6:31456087-31456109 TTCCCAGACGGGGTGGTGGCTGG + Intergenic
1006141289 6:31931784-31931806 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1006209649 6:32384706-32384728 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1006281691 6:33059471-33059493 CTCCCAGACGGGGTGGTGGCGGG + Intergenic
1006351727 6:33525622-33525644 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1006403719 6:33832461-33832483 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1006471732 6:34233183-34233205 GACCCAGGCCGGTAGGAGGTGGG - Intergenic
1006492729 6:34398600-34398622 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1006546817 6:34787013-34787035 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1006617663 6:35340789-35340811 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1006624094 6:35385109-35385131 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1006632009 6:35436575-35436597 GCCCCAGGCCTGCTGGTGGGAGG - Intergenic
1006950851 6:37820021-37820043 GTGCCCGGCCGGGTGGGGGCGGG + Intronic
1007063357 6:38964217-38964239 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1007403272 6:41616666-41616688 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1007674040 6:43580430-43580452 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1008112014 6:47505549-47505571 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1008553489 6:52655501-52655523 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1008624547 6:53304946-53304968 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1008919307 6:56824972-56824994 CTCCCAGACCAGGTGGTGGCCGG - Intronic
1008965633 6:57311082-57311104 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1009844844 6:69122041-69122063 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1010030209 6:71265930-71265952 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1010239495 6:73601912-73601934 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1010245757 6:73660363-73660385 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1010319438 6:74489006-74489028 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
1010400391 6:75441501-75441523 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1011148410 6:84244281-84244303 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1011297151 6:85838360-85838382 ATCCCAGACGGGGTGGTGGCCGG - Intergenic
1011297418 6:85839157-85839179 CTCCCAGACGGGGTGGTGGCAGG - Intergenic
1011404965 6:87009582-87009604 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1011474296 6:87736405-87736427 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1011475947 6:87750892-87750914 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1011588515 6:88948585-88948607 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1012428764 6:99142340-99142362 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1012479279 6:99650051-99650073 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1012983493 6:105853625-105853647 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1013190945 6:107803523-107803545 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1013204874 6:107935264-107935286 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1013206957 6:107953940-107953962 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1013244078 6:108270408-108270430 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1013326277 6:109047568-109047590 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1013679528 6:112508856-112508878 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1013681214 6:112528182-112528204 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1014556625 6:122848307-122848329 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1014763768 6:125388208-125388230 CTCCCAGACCGGGTCGTGGCCGG + Intergenic
1015220987 6:130802783-130802805 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1015477024 6:133665657-133665679 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1015643466 6:135363569-135363591 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1016476328 6:144433206-144433228 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1016973358 6:149785928-149785950 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1017011442 6:150066374-150066396 GACCCTGCCAGGGAGGTGGCAGG + Intronic
1017170540 6:151450675-151450697 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1017214889 6:151898920-151898942 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1017465288 6:154687726-154687748 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1017493684 6:154966120-154966142 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1017660786 6:156670639-156670661 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1017782736 6:157728953-157728975 TAGCCAGGCATGGTGGTGGCAGG + Intronic
1017830888 6:158127470-158127492 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1017843188 6:158238948-158238970 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1017992989 6:159506384-159506406 GACCCAGGCTGGGTGTGGTCTGG + Intergenic
1018009963 6:159660704-159660726 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1018528230 6:164736587-164736609 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1018812609 6:167308572-167308594 GAACCAGGGCAGGAGGTGGCAGG + Intronic
1019456581 7:1130704-1130726 GGCCCCGGGCGGGTGGGGGCGGG + Intronic
1019651638 7:2162063-2162085 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1019669380 7:2269003-2269025 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1019674345 7:2302513-2302535 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1019674646 7:2303428-2303450 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1019910266 7:4096243-4096265 GAACCAGGCCTGGCTGTGGCAGG + Intronic
1019953148 7:4390120-4390142 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1019981453 7:4624374-4624396 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1020284537 7:6670743-6670765 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1020325816 7:6974879-6974901 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1020498909 7:8890759-8890781 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1020831874 7:13103145-13103167 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1021120127 7:16789573-16789595 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1021647514 7:22801321-22801343 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1021672159 7:23045815-23045837 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1021992013 7:26148532-26148554 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1022005574 7:26262493-26262515 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1022083594 7:27045621-27045643 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1022274136 7:28838999-28839021 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1022318249 7:29264210-29264232 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1022393205 7:29961590-29961612 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1023044280 7:36197387-36197409 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1023160774 7:37293192-37293214 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1023232741 7:38051379-38051401 TACCCAGGCCTGCAGGTGGCAGG + Intergenic
1023940920 7:44767970-44767992 GAAGCAGGCTGGGTGGGGGCAGG - Exonic
1023954077 7:44871316-44871338 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1023971263 7:44992690-44992712 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1024216800 7:47255155-47255177 GGCCCAGGCAGGGATGTGGCAGG - Intergenic
1024309948 7:47959843-47959865 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1024539025 7:50460523-50460545 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1024625730 7:51207841-51207863 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1024931099 7:54667534-54667556 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1024988870 7:55219597-55219619 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1025000731 7:55312599-55312621 GACCGAGGCCGGCTTGTTGCGGG + Intergenic
1025011368 7:55402062-55402084 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1025103488 7:56152003-56152025 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1025706987 7:63874641-63874663 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1025778332 7:64577593-64577615 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1025793778 7:64718344-64718366 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1025795783 7:64738309-64738331 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1025800943 7:64785178-64785200 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1025803424 7:64809105-64809127 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1025808595 7:64857122-64857144 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1026783147 7:73283809-73283831 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1026862017 7:73797110-73797132 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1026868543 7:73836756-73836778 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1027371430 7:77510052-77510074 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1027373691 7:77533420-77533442 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1027415957 7:77975151-77975173 TAGCCAGGCATGGTGGTGGCGGG + Intergenic
1028227189 7:88266001-88266023 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1028535633 7:91887638-91887660 CTCCCAGGCGGGGTGGCGGCCGG - Intergenic
1028685400 7:93585743-93585765 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1029123768 7:98284159-98284181 GCACCAGGCAGGGTGGAGGCTGG + Intronic
1029279696 7:99427578-99427600 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1029334330 7:99887830-99887852 CTCCCAGACGGGGTGGTGGCTGG + Intronic
1029429666 7:100522718-100522740 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1029468430 7:100740821-100740843 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1029525829 7:101092811-101092833 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1029569408 7:101359880-101359902 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG + Intronic
1029996427 7:105012719-105012741 GACCCAGGCCGGGGCGGGGGAGG - Intergenic
1030033288 7:105388400-105388422 GACCCGGGGCGGGAGGTCGCGGG + Intronic
1030706420 7:112697612-112697634 TTCCCAGACAGGGTGGTGGCCGG + Intergenic
1032042687 7:128576531-128576553 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1032056790 7:128689882-128689904 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1032179508 7:129663364-129663386 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1032291000 7:130590667-130590689 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1032291440 7:130591874-130591896 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1032404992 7:131649532-131649554 AACCAAGGAGGGGTGGTGGCAGG - Intergenic
1032569997 7:132985877-132985899 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1032589424 7:133177789-133177811 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1033173154 7:139101486-139101508 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1033185689 7:139225583-139225605 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1033219659 7:139520036-139520058 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1033279633 7:139996488-139996510 CACCCAGGTGGGGTGGTGGAGGG + Intronic
1033290260 7:140077313-140077335 CACCCATGCCGGGAGCTGGCAGG + Intergenic
1033333165 7:140431863-140431885 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1033376045 7:140763128-140763150 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1034234399 7:149555319-149555341 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1034337854 7:150334871-150334893 TAGCCAGGCATGGTGGTGGCGGG + Intronic
1034361793 7:150506230-150506252 ACCCCAGACGGGGTGGTGGCCGG + Intergenic
1034450745 7:151135993-151136015 GCCCCATGATGGGTGGTGGCCGG - Intronic
1035507667 8:149367-149389 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
1035774531 8:2177983-2178005 GGCCCAGGGAGGGTGGTGGGCGG + Intergenic
1036482918 8:9153925-9153947 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1036506883 8:9364895-9364917 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1036536465 8:9657141-9657163 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1036737340 8:11330392-11330414 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1036828967 8:12005713-12005735 TAGCCAGGCGTGGTGGTGGCTGG + Intergenic
1036834201 8:12045663-12045685 TAGCCAGGCGTGGTGGTGGCTGG + Intergenic
1036856045 8:12292228-12292250 TAGCCAGGCGTGGTGGTGGCTGG + Intergenic
1038571306 8:28665218-28665240 GAGTCAGGCATGGTGGTGGCAGG - Intronic
1039488311 8:37928172-37928194 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1039753120 8:40496345-40496367 CTCCCAGGCGGGGTGGCGGCCGG + Intergenic
1039753245 8:40496811-40496833 TTCCCAGACAGGGTGGTGGCTGG + Intergenic
1039881082 8:41626231-41626253 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1040041245 8:42918938-42918960 CTCCCAGGCGGGGTGGCGGCCGG + Intronic
1040043321 8:42939238-42939260 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1040121146 8:43687394-43687416 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1040520202 8:48169835-48169857 GAACAAAGCTGGGTGGTGGCTGG - Intergenic
1041071000 8:54125914-54125936 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1041286855 8:56271898-56271920 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1041362859 8:57071310-57071332 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1041513530 8:58676319-58676341 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1041676715 8:60547417-60547439 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1041796279 8:61752393-61752415 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1042049337 8:64686602-64686624 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1042139411 8:65663004-65663026 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1042303883 8:67311711-67311733 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1042475898 8:69246334-69246356 CTCCCAGACAGGGTGGTGGCCGG - Intergenic
1044190432 8:89310247-89310269 CTCCCAGACTGGGTGGTGGCCGG + Intergenic
1044507751 8:93039684-93039706 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1044969353 8:97604765-97604787 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1045007448 8:97928661-97928683 GCCCCAGGCTGGGTAGGGGCAGG - Intronic
1045215654 8:100145906-100145928 GACCCAGGCCTGCGGGCGGCCGG - Intergenic
1045298396 8:100891992-100892014 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1046736039 8:117777712-117777734 CTCCCAGACCGGGTGGCGGCGGG - Intergenic
1047267118 8:123316057-123316079 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1047685889 8:127304391-127304413 TAGCCAGGCGTGGTGGTGGCAGG - Intergenic
1047687665 8:127317354-127317376 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1047781886 8:128118336-128118358 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1047847645 8:128825502-128825524 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1048284045 8:133127788-133127810 GAGCCAGGGCAGGTGGGGGCTGG - Intronic
1048368736 8:133758539-133758561 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1049177272 8:141202070-141202092 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1049704962 8:144037291-144037313 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1049739581 8:144231329-144231351 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1049800078 8:144513584-144513606 GACCCAGGCTGCGTGCAGGCAGG + Exonic
1050534963 9:6623089-6623111 CTCCCAGACGGGGTGGTGGCGGG - Intronic
1050557050 9:6798760-6798782 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1050558371 9:6808167-6808189 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1050564239 9:6865897-6865919 TAGCCAGGCATGGTGGTGGCGGG - Intronic
1051277099 9:15407202-15407224 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1051353326 9:16218476-16218498 GAGCCAGGCCGGGCTGTGGACGG + Intronic
1051430524 9:16977263-16977285 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1051615311 9:19000324-19000346 TTCCCAGACAGGGTGGTGGCTGG - Intronic
1052259096 9:26492715-26492737 CTCCCAGACCGGGTGGCGGCCGG - Intergenic
1052492562 9:29188594-29188616 CTCCCAGACCGGGTCGTGGCCGG + Intergenic
1052881137 9:33601298-33601320 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1053048224 9:34937123-34937145 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1053081891 9:35183872-35183894 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1053082001 9:35184294-35184316 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1053255665 9:36614958-36614980 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1053467918 9:38324436-38324458 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1053468277 9:38325440-38325462 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1053634534 9:39983342-39983364 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
1054209353 9:62267355-62267377 CTCCCAGACCGGGTGGTGGCCGG + Intergenic
1054359822 9:64101395-64101417 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1055133771 9:72806065-72806087 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1055136915 9:72840112-72840134 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1055414040 9:76063850-76063872 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1055518824 9:77060674-77060696 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1055580405 9:77702625-77702647 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1055948737 9:81711383-81711405 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1056145896 9:83728853-83728875 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1056336460 9:85573944-85573966 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1056564499 9:87759484-87759506 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1056624641 9:88244613-88244635 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1056670962 9:88626500-88626522 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1056706824 9:88959222-88959244 CTCCCAGGCGGGGTGGTGGCCGG + Intergenic
1056909130 9:90682254-90682276 TAGCCAGGCATGGTGGTGGCGGG + Intergenic
1057087758 9:92227326-92227348 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1057206015 9:93173168-93173190 GACTCAGGCCTGGGGCTGGCAGG - Intergenic
1057395569 9:94676812-94676834 GACCCAGGCAGTTTGCTGGCTGG + Intergenic
1057418326 9:94885513-94885535 CAGCCAGGCCTGGTGCTGGCTGG + Intronic
1057629309 9:96707358-96707380 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1057726608 9:97572586-97572608 GCCCCAGGCTGGGGGGAGGCAGG + Intronic
1057751706 9:97797117-97797139 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1057802876 9:98200548-98200570 TACCCCGGCGGGGTGGTGGGGGG + Intronic
1058659458 9:107256575-107256597 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1058661701 9:107272562-107272584 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1058723209 9:107777752-107777774 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1058972652 9:110097473-110097495 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1059061423 9:111038314-111038336 GACCCCGGCGGGGTGGGCGCAGG - Intronic
1059118064 9:111617367-111617389 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
1059121373 9:111642083-111642105 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1060041591 9:120305262-120305284 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1060065482 9:120496884-120496906 CTCCCAGACAGGGTGGTGGCCGG - Intronic
1060249236 9:121971543-121971565 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1060350318 9:122852855-122852877 CTCCCAGACGGGGTGGTGGCTGG - Intronic
1060352155 9:122868215-122868237 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1060369747 9:123057637-123057659 TTCCCAGACAGGGTGGTGGCCGG + Intronic
1060625643 9:125108833-125108855 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1060651184 9:125328721-125328743 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1060682590 9:125577905-125577927 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1060687531 9:125624713-125624735 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1060703974 9:125781104-125781126 TTCCCAGACGGGGTGGTGGCTGG + Intronic
1060773018 9:126346473-126346495 CAGCCAGGTCGGGTGGAGGCGGG + Intronic
1061059913 9:128245104-128245126 AGCACAGGGCGGGTGGTGGCGGG + Intronic
1061143221 9:128780623-128780645 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1061193359 9:129094755-129094777 GAGGCAGGCAGGGTGGGGGCAGG - Intergenic
1061369618 9:130191151-130191173 GACCCAGGCCACGTGGCGACTGG + Intronic
1061635955 9:131908350-131908372 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1061831721 9:133300306-133300328 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1061843989 9:133376416-133376438 GACCCACGCGGGGTGGGGCCAGG + Exonic
1061914936 9:133744985-133745007 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1061941942 9:133888501-133888523 GACCCAGGGCCGGTGGTGTAGGG - Intronic
1061982578 9:134115303-134115325 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1062249986 9:135589052-135589074 GGCCCAGGCAGGGCCGTGGCAGG - Intergenic
1062339227 9:136086528-136086550 GACCGTGGCTGGGTGCTGGCAGG - Intronic
1062461924 9:136665856-136665878 GACCCAGCCCGGGCGGCGACCGG - Intronic
1062519497 9:136951820-136951842 GAGCCAGGCAGGGTGGGGGTAGG + Intronic
1062547314 9:137069621-137069643 CACCAGGGCCGGGGGGTGGCAGG - Intronic
1062571178 9:137186095-137186117 GGCCCAGACCGGGTGGTGGCTGG - Intronic
1062593894 9:137288621-137288643 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1062597482 9:137305796-137305818 CAGCCAGGCCGGGTGGAGGGTGG + Intergenic
1203463744 Un_GL000220v1:67875-67897 CTCCCAGACGGGGTGGTGGCAGG + Intergenic
1185604732 X:1361602-1361624 TACCCAGACGTGGTGGTGGCAGG + Intronic
1185628157 X:1497071-1497093 TAGCCAGGCGTGGTGGTGGCGGG + Intronic
1186512329 X:10139201-10139223 GACAGAGGCCAGGGGGTGGCTGG - Intronic
1186787102 X:12963893-12963915 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1186922923 X:14302612-14302634 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1187183372 X:16964550-16964572 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1187184085 X:16968362-16968384 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1187215807 X:17275505-17275527 TTCCCAGACGGGGTGGTGGCTGG + Intergenic
1187215818 X:17275545-17275567 TTCCCAGACGGGGTGGTGGCTGG + Intergenic
1187215829 X:17275585-17275607 TTCCCAGACGGGGTGGTGGCTGG + Intergenic
1187976288 X:24708906-24708928 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1188477542 X:30603354-30603376 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1188492650 X:30753877-30753899 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1188492785 X:30754354-30754376 TTCCCAGACGGGGTGGTGGCTGG + Intergenic
1188942819 X:36261845-36261867 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1189056757 X:37707152-37707174 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1189210543 X:39278484-39278506 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
1189458100 X:41211935-41211957 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1189506128 X:41613105-41613127 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1189587169 X:42473931-42473953 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1189955712 X:46275120-46275142 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1189956054 X:46276116-46276138 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1189968166 X:46395178-46395200 CTCCCGGACCGGGTGGTGGCCGG + Intergenic
1190171673 X:48115822-48115844 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1190184595 X:48222678-48222700 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1190241149 X:48659221-48659243 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1190680795 X:52826707-52826729 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1190819033 X:53956099-53956121 TAGCCAGGCATGGTGGTGGCGGG + Intronic
1190839064 X:54128992-54129014 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1190891425 X:54572526-54572548 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1191617879 X:63189132-63189154 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1191637526 X:63393626-63393648 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1191861238 X:65667935-65667957 GTCCCAGGCGGGCCGGTGGCTGG - Intronic
1192252052 X:69421806-69421828 TTCCCAGACGGGGTGGTGGCTGG - Intergenic
1192350105 X:70349601-70349623 ATCCCAGACGGGGTGGTGGCCGG + Intronic
1192350160 X:70349798-70349820 ATCCCAGACGGGGTGGTGGCTGG + Intronic
1192352759 X:70371496-70371518 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1192386713 X:70679350-70679372 TTCCCAGACGGGGTGGTGGCCGG - Intronic
1192386950 X:70680055-70680077 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1192463853 X:71341198-71341220 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1192476899 X:71451997-71452019 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1192621673 X:72682398-72682420 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1192768988 X:74167603-74167625 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1192794082 X:74412483-74412505 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1192813309 X:74568428-74568450 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1192969584 X:76217674-76217696 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1193068193 X:77279776-77279798 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1193114778 X:77766210-77766232 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1193164715 X:78266024-78266046 TTCCCAGACGGGGTGGTGGCCGG + Intergenic
1193345129 X:80396794-80396816 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1193345352 X:80397514-80397536 TTCCCAGACGGGGTGGTGGCCGG + Intronic
1193362419 X:80591719-80591741 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1193372444 X:80713164-80713186 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1193889969 X:87033171-87033193 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1193924460 X:87466341-87466363 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1194181120 X:90713520-90713542 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1194539938 X:95157291-95157313 GACCCAAGCCTGGTGGTGGCGGG - Intergenic
1195010017 X:100724344-100724366 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1195035937 X:100972250-100972272 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1195037369 X:100982192-100982214 GAACGAGGCCTGGAGGTGGCTGG + Intronic
1195257462 X:103104370-103104392 CTCCCAGACAGGGTGGTGGCCGG + Intergenic
1195889010 X:109671478-109671500 CACCCCGTCCGGGAGGTGGCAGG + Intronic
1196404171 X:115347019-115347041 CTCCCAGACGGGGTGGTGGCCGG + Intergenic
1197199368 X:123734456-123734478 CTCCCAGACCGGGTGGTGGCCGG - Intergenic
1197241666 X:124128466-124128488 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1197453056 X:126641808-126641830 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1197736303 X:129851444-129851466 CTCCCAGACGGGGTGGTGGCTGG - Intergenic
1197897177 X:131327699-131327721 CTCCCAGACGGGGTGGTGGCCGG - Intronic
1198476128 X:136999872-136999894 CTCCCAGACGGGGTGGTGGCTGG + Intergenic
1199230883 X:145436038-145436060 TTCCCAGACGGGGTGGTGGCCGG - Intergenic
1199452535 X:147992179-147992201 CTCCCAGACGGGGTGGTGGCCGG + Intronic
1199688915 X:150291261-150291283 GCCCCTGGCCAGGAGGTGGCTGG + Intergenic
1199836740 X:151599452-151599474 CGCCCAGTCCGGGAGGTGGCGGG - Intronic
1200092541 X:153642643-153642665 CAGCCAGGCCGGGTGGGGGGTGG - Intronic
1201282316 Y:12352397-12352419 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1201335859 Y:12879026-12879048 CTCCCAGACGGGGTGGTGGCCGG - Intergenic
1202029026 Y:20552645-20552667 TCCCCAGACAGGGTGGTGGCCGG - Intergenic
1202388618 Y:24347992-24348014 GGCCCAGGCTGGGTGGGGGCGGG - Intergenic
1202482169 Y:25322136-25322158 GGCCCAGGCTGGGTGGGGGCGGG + Intergenic