ID: 1080589110

View in Genome Browser
Species Human (GRCh38)
Location 11:33705949-33705971
Sequence TAGGATCAGCCTACTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080589104_1080589110 25 Left 1080589104 11:33705901-33705923 CCAGCTTGGGTGGGGCTATTGAG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1080589110 11:33705949-33705971 TAGGATCAGCCTACTGGGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 76
1080589106_1080589110 -6 Left 1080589106 11:33705932-33705954 CCAGCACTGATCATATATAGGAT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1080589110 11:33705949-33705971 TAGGATCAGCCTACTGGGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080589110 Original CRISPR TAGGATCAGCCTACTGGGGT TGG Intronic
900118008 1:1036717-1036739 TAGGAACAGCCTGGTGGGGTTGG - Intronic
901197971 1:7450913-7450935 TAGGATGATCCTCCTGGGGGTGG - Intronic
904636357 1:31884585-31884607 GAGGAGAAGCCTACTGTGGTCGG + Intergenic
907475313 1:54701428-54701450 TTGGGTCAGCCTACTGGGAGAGG + Intronic
911650060 1:100377671-100377693 TAGGATCTGCTCAGTGGGGTTGG + Intronic
914256475 1:145964131-145964153 TGGGATCAGCGTACCAGGGTTGG - Intronic
924100716 1:240600058-240600080 TAGGGTCAGCCTAATGGTGGAGG + Intronic
1072780079 10:98244347-98244369 TGGAATCACCCTACTGTGGTGGG + Exonic
1073268146 10:102240878-102240900 TAGGCTCAGACTCCTGGGGCTGG - Intronic
1075244259 10:120806503-120806525 TAGGTTAAGCCTCCTGGGGCTGG + Intergenic
1077183955 11:1228288-1228310 TTGGCTCCGCCTCCTGGGGTGGG + Intronic
1077251603 11:1563230-1563252 TAGAATCCACCTCCTGGGGTCGG - Intronic
1078005029 11:7526240-7526262 GTGGATCAACCAACTGGGGTGGG + Intronic
1080589110 11:33705949-33705971 TAGGATCAGCCTACTGGGGTTGG + Intronic
1085837563 11:79973017-79973039 TAAAGGCAGCCTACTGGGGTAGG + Intergenic
1091487506 12:904006-904028 TACTATCAGTCTACTGTGGTGGG + Intronic
1099057633 12:77864983-77865005 TAGGATTAGCCTCCTGGAATTGG + Intronic
1101702968 12:107192821-107192843 TTGGATCAGGCTACCTGGGTTGG + Intergenic
1102707554 12:114895486-114895508 TAGGCTCAGCTAACTGTGGTCGG + Intergenic
1103016810 12:117500995-117501017 TAGAATCAGGCTTCTGAGGTGGG + Intronic
1103040781 12:117693753-117693775 TAGGACCCGCTTCCTGGGGTTGG - Intronic
1103929609 12:124442809-124442831 TAGAATGAGGTTACTGGGGTGGG + Intronic
1106259752 13:28056082-28056104 AAGCATCATCTTACTGGGGTTGG - Intronic
1112096914 13:96143819-96143841 TAGCAGCATCCTAATGGGGTTGG + Intronic
1112369961 13:98785592-98785614 CAGGCTCAGCCCACTGGGGTGGG + Intergenic
1113335245 13:109370776-109370798 GTGCATCAGCCTGCTGGGGTTGG - Intergenic
1113375249 13:109759316-109759338 CAGCCTCAGCCTCCTGGGGTGGG - Intronic
1113634952 13:111913105-111913127 GAGGCTCCGCCTACTGGAGTTGG - Intergenic
1117868986 14:60178028-60178050 TATGGTTAGCCTACTGTGGTAGG - Intergenic
1121790588 14:96696748-96696770 CAGGAACAGCCTGCTGGGGATGG + Intergenic
1122406380 14:101503542-101503564 TGGGGTCAGCCAACTTGGGTTGG - Intergenic
1128899466 15:71407326-71407348 TAGGATCAGCTTTCTTGGGTCGG + Intronic
1134436586 16:14264322-14264344 TCAGATCATCCTACTGGGGGTGG + Exonic
1147452040 17:40511836-40511858 TAGGAGCATCCTCCTGGGATGGG - Intergenic
1147572681 17:41581013-41581035 TTGAATCAGACTACTTGGGTTGG - Intergenic
1148022537 17:44562882-44562904 TAGGTTCAGCCCAGTGGGATGGG + Intergenic
1149773058 17:59336352-59336374 TAGAATAAGGTTACTGGGGTAGG - Intronic
1151675448 17:75595122-75595144 TGGGCTGAGCCTGCTGGGGTGGG + Intergenic
1159349597 18:67254654-67254676 TAGTGTCAGACTACTGGGGTTGG + Intergenic
1161441915 19:4296714-4296736 TAGGACCAGCCTGCTGGCGGGGG - Intronic
1165435378 19:35792194-35792216 TAGCCTCAGCATCCTGGGGTGGG + Intergenic
931757184 2:65384625-65384647 TAGCATCTGCCTTCTGGGGTCGG - Intronic
933695441 2:85213968-85213990 CAGGAGCATCCCACTGGGGTGGG - Intronic
936109862 2:109656084-109656106 TAGGATCATCCTGCTGAGGCAGG - Intergenic
938084298 2:128388655-128388677 TAAAATCAGCCTTCAGGGGTGGG + Intergenic
941091058 2:161176046-161176068 TAGCATCAGCCTCTTGGGTTTGG + Intronic
946127150 2:217572896-217572918 GAGGAACATCCTAGTGGGGTTGG + Intronic
1172572218 20:35979627-35979649 TAGCAAGAGCCTACTGGGGAAGG + Intronic
1173227589 20:41171017-41171039 TAGGACCAGCCTTCTGGAGAAGG + Intronic
1173802928 20:45906098-45906120 TAGGTTCAGCCTCCTGGGTCTGG - Intronic
949517548 3:4821088-4821110 TAGCTACAGCCTCCTGGGGTTGG - Intronic
949594702 3:5531707-5531729 TAGGTTCAGCTGACTGGGTTTGG + Intergenic
950008174 3:9704619-9704641 CTGGAGCCGCCTACTGGGGTCGG - Exonic
950414132 3:12858681-12858703 CAGGATCAGCCAGCTGGGGTGGG + Intronic
952161913 3:30702368-30702390 TTGGTTCAGCCTAAAGGGGTGGG + Intergenic
957497689 3:81011427-81011449 AAGGTGCAGCCTACTGAGGTAGG - Intergenic
966656126 3:182360487-182360509 TAGGAGCAGCCTACAGGTGAGGG + Intergenic
969155502 4:5206282-5206304 TAGGACCATCCTACTGTGGAGGG - Intronic
975593574 4:76024827-76024849 TAGGATCAGGCTACTGTACTAGG + Intronic
975791603 4:77958833-77958855 GAGGATCAGCCTCCGGGGGCTGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
995840536 5:116439526-116439548 TAATAACAGCCTAGTGGGGTGGG - Intergenic
997694325 5:135849619-135849641 TAGGACCACCCAACTAGGGTAGG - Intronic
1001673886 5:173496685-173496707 TAGGATGAGCCTCCTGGTGGAGG + Intergenic
1003991658 6:11492664-11492686 TGGGCTGAGCCTACTGGTGTGGG + Intergenic
1006320083 6:33314990-33315012 AAGGGGCAGGCTACTGGGGTGGG - Exonic
1006771928 6:36560947-36560969 TAGGATCTGCTAACTGGGGAGGG - Intergenic
1014045354 6:116877693-116877715 AAGGAGTAGCCTACTGGGGTGGG - Intronic
1019418869 7:940135-940157 CATGAACAGCCTACTGGGGAGGG + Intronic
1019569552 7:1704553-1704575 TAGGTGGAGCCTCCTGGGGTGGG - Intronic
1029191575 7:98775896-98775918 CAGGAAGAGCCCACTGGGGTGGG - Intergenic
1036390001 8:8317186-8317208 GAGGATCAGCCTCCTGGGGCAGG - Intergenic
1040454109 8:47578641-47578663 TAGGATCTGTCTACAGGGTTTGG - Intronic
1042362833 8:67902154-67902176 CCGGATCAGCCTCCTGGGGCAGG - Intergenic
1042882129 8:73505295-73505317 CAGGATCAGTTTACTGGGCTGGG + Intronic
1045130256 8:99143924-99143946 TAGGTTCTGTCTACTGGGATGGG + Intronic
1045640174 8:104241102-104241124 TAGAAGCAGCTTAGTGGGGTGGG - Intronic
1046350634 8:113006451-113006473 TAGCACCAGCCTAGTAGGGTGGG + Intronic
1049234726 8:141506921-141506943 CAGGAGCAGCCTGCAGGGGTTGG - Intergenic
1055825475 9:80318968-80318990 TGAGATCACCCTATTGGGGTAGG + Intergenic
1061194859 9:129102200-129102222 TTGGATCACCCTTCTGGGCTGGG + Intronic
1061668857 9:132176881-132176903 TAGGATGAGCCTAGTGGGTGTGG + Intronic
1188377964 X:29456305-29456327 CAGGATCAGTTTTCTGGGGTGGG + Intronic
1189664437 X:43338877-43338899 TAGCATCAGCCTTCTTGCGTGGG - Intergenic
1199179155 X:144833222-144833244 TAAGTTTAGCCTGCTGGGGTAGG - Intergenic