ID: 1080589966

View in Genome Browser
Species Human (GRCh38)
Location 11:33714407-33714429
Sequence TCACAGTAAGTGCCCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 2, 1: 14, 2: 57, 3: 223, 4: 527}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080589966_1080589972 30 Left 1080589966 11:33714407-33714429 CCTGTACAGGGCACTTACTGTGA 0: 2
1: 14
2: 57
3: 223
4: 527
Right 1080589972 11:33714460-33714482 TGAGTGGTGGGCGAATGTGAAGG 0: 1
1: 26
2: 427
3: 613
4: 718
1080589966_1080589968 -4 Left 1080589966 11:33714407-33714429 CCTGTACAGGGCACTTACTGTGA 0: 2
1: 14
2: 57
3: 223
4: 527
Right 1080589968 11:33714426-33714448 GTGAATGGAGCTTGTGAGATTGG 0: 1
1: 1
2: 2
3: 39
4: 319
1080589966_1080589971 18 Left 1080589966 11:33714407-33714429 CCTGTACAGGGCACTTACTGTGA 0: 2
1: 14
2: 57
3: 223
4: 527
Right 1080589971 11:33714448-33714470 GAAGTCAGTGAATGAGTGGTGGG 0: 1
1: 0
2: 5
3: 50
4: 290
1080589966_1080589970 17 Left 1080589966 11:33714407-33714429 CCTGTACAGGGCACTTACTGTGA 0: 2
1: 14
2: 57
3: 223
4: 527
Right 1080589970 11:33714447-33714469 GGAAGTCAGTGAATGAGTGGTGG 0: 1
1: 0
2: 4
3: 50
4: 428
1080589966_1080589969 14 Left 1080589966 11:33714407-33714429 CCTGTACAGGGCACTTACTGTGA 0: 2
1: 14
2: 57
3: 223
4: 527
Right 1080589969 11:33714444-33714466 ATTGGAAGTCAGTGAATGAGTGG 0: 1
1: 0
2: 0
3: 28
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080589966 Original CRISPR TCACAGTAAGTGCCCTGTAC AGG (reversed) Intronic
901754637 1:11434214-11434236 TCAAGGTAAGTGCCCAGTACTGG + Intergenic
902774356 1:18665137-18665159 GCACAGTAAGTGCTCAGTAAAGG + Intronic
902935750 1:19763454-19763476 ACACAGTAAGTGCCCGATACAGG + Intronic
904047540 1:27617474-27617496 ACACAGTAGGTGCCCTGCAAAGG + Intronic
905829278 1:41051975-41051997 TCACGGTAAGTACCCTGTATAGG + Intronic
907081826 1:51630536-51630558 TCATGGTAAGTGCCCTATACAGG - Intronic
907087594 1:51691065-51691087 TCATGGTAAGTGCCCTATACAGG - Intronic
907577619 1:55541587-55541609 TCACAGTAAGTGTCCTGTACAGG + Intergenic
907768379 1:57434853-57434875 TCATAGTAAGTGCTCTATATAGG - Intronic
908771080 1:67596426-67596448 TCACGGTAAGTACCCTATACGGG - Intergenic
909027486 1:70499939-70499961 TCATGGTAAGTGCCCTATACAGG + Intergenic
909418620 1:75436495-75436517 TCATGGTAAGTGCTCTATACAGG - Intronic
909782814 1:79568871-79568893 TCATGGTAAATGTCCTGTACAGG - Intergenic
910660410 1:89665847-89665869 TCATGGTAAGTACCCTATACAGG + Intronic
911061832 1:93755411-93755433 TCATGGTAAGTGCCCTATACAGG + Intronic
911085052 1:93969608-93969630 TTATGGTAAGTGCCCTATACAGG + Intergenic
911147113 1:94563020-94563042 TCACACTAATTTCCCTGTCCAGG + Intergenic
911253671 1:95609466-95609488 TCACAGTGACTGCCCTGTTCAGG - Intergenic
911661113 1:100502276-100502298 CCATGGTAAGTGCCCTTTACAGG + Intronic
912060995 1:105669993-105670015 TCATGGTAAGTGCCCTATAGAGG + Intergenic
912385764 1:109270506-109270528 CCTCAGTGAGTGCCCGGTACAGG - Exonic
912701026 1:111878411-111878433 CCACAGCAGGTGCCCTGGACAGG - Intronic
912909414 1:113742655-113742677 TCATGATAAGTGCCCTATACAGG - Intronic
913145438 1:115985157-115985179 TCATGGTAAGTGTCCTTTACAGG + Intronic
913552550 1:119929871-119929893 TCATAGTAAATGCCCTATACAGG + Intronic
913675976 1:121140546-121140568 TTATGGTAAGTGCCCTATACAGG - Intergenic
914027871 1:143928486-143928508 TTATGGTAAGTGCCCTATACAGG - Intergenic
914406574 1:147380300-147380322 TTATAGTAAGTGCCCTATACAGG - Intergenic
915193459 1:154171472-154171494 TCACAGTAAGTGTTCTGAGCTGG - Exonic
915286321 1:154855433-154855455 TCATGGTAAGTGCCCTATACAGG + Intronic
915506678 1:156361459-156361481 TCATGGTAAGTGCCCTATGCAGG - Intronic
915647074 1:157279887-157279909 TCATGGTAAGTGCCTTATACAGG - Intergenic
915896751 1:159817487-159817509 TCATAGTAAATGTCCTATACAGG + Intergenic
916529662 1:165644454-165644476 TCATGGTAAGTGCCTTCTACAGG - Intronic
916702549 1:167312765-167312787 TCATGGTAAGTGCCCTATACAGG + Intronic
916896999 1:169174768-169174790 TCATGGTAAGTGCCCTCTATAGG - Intronic
916957801 1:169857956-169857978 TCATAGTAAATACCCTATACAGG - Intronic
917402275 1:174663206-174663228 TCTCAGTAAGTGCCCTATACAGG + Intronic
917633318 1:176911183-176911205 TCACGGTAAGTGCCCTTTACAGG - Intronic
918031506 1:180817442-180817464 TCATTGTAAGTACCCTATACAGG + Intronic
918278379 1:182977596-182977618 TCACGGTAAGTGCCTTATACAGG - Intergenic
918531697 1:185529747-185529769 TCACAGTCAGTGCCCTATACAGG + Intergenic
918790829 1:188825704-188825726 TCATGGTAAGCGCCCTATACAGG + Intergenic
918876385 1:190049974-190049996 TCATGGTAAGTGACCTATACAGG - Intergenic
919966889 1:202536441-202536463 TCACGGTAAATGCCCTATACAGG - Intronic
920173385 1:204085136-204085158 ACACAGTAGGTGCTCTGTAAAGG - Intronic
920324412 1:205151155-205151177 TCATTGTAAATGCCCTCTACAGG - Intronic
920463346 1:206159383-206159405 TTATGGTAAGTGCCCTATACAGG - Intergenic
921108892 1:212013651-212013673 TCATGGTAAGTGCCCTATACAGG + Intronic
921587066 1:216959885-216959907 TCTCAGTAAGTGCTCAGTATAGG - Intronic
921643609 1:217586016-217586038 TCATGGTAAGTGCCCTATACAGG - Intronic
921722212 1:218485474-218485496 TCATGGTAAGTGACCTATACAGG + Intergenic
921955260 1:220976531-220976553 TCATAGTAAGTACCCTGTATAGG - Intergenic
922122802 1:222689903-222689925 TCATAGTAAGTACCCTATAAAGG + Intronic
922399868 1:225241775-225241797 TCATGGTAAGTGCCCTATTCAGG - Intronic
922881217 1:228982586-228982608 TCACAGTAAGTGCTCTCTACAGG + Intergenic
923244097 1:232114260-232114282 TCATTGTAAGTGCCCTATACAGG + Intergenic
923286010 1:232496150-232496172 TCATGGTAAGTGCCCTATACAGG + Intronic
923434014 1:233951417-233951439 TCATGGTAAGTGCCCTCTACAGG + Intronic
923601191 1:235404450-235404472 TCACGCTAAGTGCCCTATGCAGG - Intronic
923925595 1:238623741-238623763 TCATGGTAAGTGCACTGTACAGG + Intergenic
924755700 1:246938810-246938832 TCATGGTAAGTGCCCTAGACAGG - Intergenic
1063419090 10:5896812-5896834 TAACAGTAAATGCCCTTTACAGG + Intronic
1063721326 10:8584818-8584840 GCACAGGAAGTGGCCTGGACTGG - Intergenic
1063807379 10:9660976-9660998 TCACGGTAAATGCCCTATACAGG - Intergenic
1063858578 10:10283226-10283248 TCATGGTGAGTGCCTTGTACAGG - Intergenic
1064813315 10:19227260-19227282 TGCCAGTAAGTTCACTGTACTGG - Intronic
1065194267 10:23247267-23247289 TCATGGTAAGTGCCTTATACAGG + Intergenic
1065781374 10:29171336-29171358 TCATGGTAGGTGCCCTATACAGG - Intergenic
1066452538 10:35544247-35544269 TTACTGTAAGTGCCCTGTACAGG + Intronic
1066637965 10:37525579-37525601 TCATGGTAAGCGCCCTCTACAGG - Intergenic
1066757856 10:38728925-38728947 TCATGGTAAGTGCCCTATACAGG + Intergenic
1067124373 10:43503566-43503588 TCATGGTAAGTGCCCTATACAGG + Intergenic
1067826134 10:49574422-49574444 TCACAGTAAGTGTCCTATCCAGG - Intergenic
1067913352 10:50370059-50370081 TCATGGTAAGTGCCCTTTATAGG - Intronic
1068288218 10:54966992-54967014 TCATGGTAATTGCCCTATACAGG - Intronic
1068546390 10:58351045-58351067 TTATGGTAAGTGCCCTATACAGG - Intronic
1068638236 10:59371485-59371507 TCATGGTTAGTGCCCTATACAGG - Intergenic
1068672811 10:59741286-59741308 TCATGGGAAGTGCCCTATACAGG + Intergenic
1068772274 10:60835559-60835581 TCATGCTAAGTGCCCTATACAGG - Intergenic
1068784497 10:60956282-60956304 TCCTAGTAAATGCCCTATACAGG - Intronic
1068820412 10:61371152-61371174 TCATGGTAATTGCCCTATACAGG - Intergenic
1069346775 10:67479309-67479331 TCAGAGTATGTTCCATGTACAGG - Intronic
1070600035 10:77859438-77859460 TTCATGTAAGTGCCCTGTACAGG + Intronic
1070701621 10:78606143-78606165 TCATGGGAAGTGCCCTCTACAGG + Intergenic
1071701500 10:87943131-87943153 TCGTGGTAAGTGCCCTATACAGG + Intronic
1072644119 10:97238890-97238912 TCATGGTAACTGCCCTATACAGG + Intronic
1072931818 10:99671057-99671079 TGATGGTAAGTGCCCTATACAGG - Intronic
1073236465 10:102020962-102020984 TCATAGTAAGTGCCCTATTCAGG + Intronic
1073851025 10:107618356-107618378 TCATGGTAAGTACCCTATACAGG + Intergenic
1073961700 10:108938517-108938539 TTATGGTAAGTGTCCTGTACAGG + Intergenic
1074259915 10:111842049-111842071 TCATGGTAAGTGCCCTACACAGG + Intergenic
1074259948 10:111842464-111842486 TCATGGTAAGTGCCCTATACAGG - Intergenic
1074626207 10:115189892-115189914 TCATGGTAAGTGTCCTATACAGG + Intronic
1075135268 10:119779236-119779258 TCATAGTAAATGCCCAATACAGG - Intronic
1075422861 10:122316672-122316694 GCATGATAAGTGCCCTGTACAGG - Intronic
1075498178 10:122946289-122946311 TCATGGTAAGTGCCCTATACAGG + Intronic
1075686290 10:124367374-124367396 TCACAGTGTGTGACCTGTGCAGG - Intergenic
1076154190 10:128190462-128190484 TCATGGTAAGTGCTCTATACAGG - Intergenic
1076165894 10:128282329-128282351 TCATGGTAAGTGCCCTACACAGG - Intergenic
1076182032 10:128417227-128417249 TCATGGTAAGTGCCCTACACAGG + Intergenic
1076617660 10:131766832-131766854 TCATGATAAGTGCCCTATACAGG - Intergenic
1077670902 11:4156754-4156776 TCACTGTTACTGCCCTGTTCTGG + Intergenic
1077860654 11:6175891-6175913 TCACTGTTCCTGCCCTGTACAGG + Intergenic
1077871599 11:6267034-6267056 TAACGGTACGTGCCCTATACAGG - Intronic
1077958178 11:7044004-7044026 TCCCTGGAAGTGCCCTGTAAGGG + Intronic
1078281989 11:9911708-9911730 TCACGGTAATTGTCCTATACAGG + Intronic
1078343406 11:10519776-10519798 TTATGGTAAGTGCCCTATACAGG - Intronic
1078411226 11:11120863-11120885 TCATGGTAAGTGCCCTATACAGG + Intergenic
1078550645 11:12278024-12278046 TTATAGTAAGTGCCCTATATAGG - Intronic
1078644551 11:13128298-13128320 TCATGGTAAGTACCCTATACAGG + Intergenic
1078645092 11:13134775-13134797 TCATAGTAAGTGCCCTATGCAGG - Intergenic
1078803874 11:14676485-14676507 TCATGGTAAGTGCCCTATACAGG - Intronic
1078881548 11:15454248-15454270 TAACAGTAAGTTCCCTCTAATGG + Intergenic
1079514140 11:21247083-21247105 TCATGGTAAGTGCCCTATATAGG - Intronic
1079837559 11:25352386-25352408 TCACAGTAACTGCTCTATAAAGG - Intergenic
1080436156 11:32246664-32246686 TCATGGTAAGTGCCCCATACAGG - Intergenic
1080589966 11:33714407-33714429 TCACAGTAAGTGCCCTGTACAGG - Intronic
1080734152 11:34994368-34994390 TCACGGTAAGTGCCCTAAACAGG - Intronic
1081408715 11:42729071-42729093 TCATTGTAAGTGCCCTATAAAGG - Intergenic
1082220886 11:49634871-49634893 TCATGGTAAATGCCCTATACGGG - Intergenic
1083072931 11:60005604-60005626 TCATAGTAAGTGCCTTATACAGG + Intergenic
1084135485 11:67176809-67176831 TCACAAGAAGTGCCCTATACAGG - Intronic
1084453258 11:69252358-69252380 CCACAGGAGGTGCCCTGTGCAGG - Intergenic
1085115438 11:73927483-73927505 TCACAGAAAGTCAGCTGTACTGG + Exonic
1085180395 11:74530640-74530662 TCATGGTAAGTGACCTATACAGG + Intronic
1085540727 11:77267047-77267069 TCATGGTAAATGCCCTATACAGG + Intronic
1085555744 11:77419825-77419847 CCACAGTAAGTGACCTTAACAGG - Intronic
1085677388 11:78536865-78536887 TCATGGTAAGTGCCCTATACAGG + Intronic
1085910485 11:80819177-80819199 TCATGGTAAGTGCCCTATACAGG - Intergenic
1087540520 11:99512161-99512183 TCAAAGTAAGAGCCCTAGACAGG + Intronic
1087574977 11:99978484-99978506 TTGTAGTAAATGCCCTGTACAGG + Intronic
1087727182 11:101734064-101734086 TTATGGTAAGTGCCCTTTACAGG + Intronic
1087734647 11:101818327-101818349 TCATGGTAAGTGCCCTATGCAGG - Intronic
1087884125 11:103458147-103458169 TCATGGTAAGTGCCCTGAACAGG + Intronic
1088086834 11:105991190-105991212 TCATGGTAAGTGCCCTATACAGG - Intergenic
1088266072 11:107988893-107988915 TCATGGTAAGTGCCCTATACCGG - Intergenic
1088462675 11:110098580-110098602 TCATGGTAAGTGCCCTATATAGG + Intronic
1088744021 11:112789651-112789673 TCACGGTGAGTGCCCTAGACAGG - Intergenic
1088856741 11:113762294-113762316 TCATGGTAAGTGCCCTATACAGG - Intronic
1090093305 11:123718903-123718925 TCATGGTAAGTGCCCTATACAGG - Intergenic
1090182483 11:124712775-124712797 TCATGGTGAGTGCCCTATACGGG - Intergenic
1090516688 11:127435919-127435941 TCATGGTGAGTGCCCTATACAGG - Intergenic
1090537046 11:127654223-127654245 TCATGGTAAGTGCCCTATATAGG + Intergenic
1090652331 11:128818122-128818144 TCATGGTAAGTGCCCTATACAGG - Intergenic
1090708500 11:129362898-129362920 TCACAGTAACAGACCTGTAGTGG - Intergenic
1090970201 11:131635815-131635837 TCATAGTAAGTGCCCTATACAGG + Intronic
1091364141 11:135003323-135003345 TTATACTAAGTGTCCTGTACAGG - Intergenic
1091628881 12:2143418-2143440 TCATGGTAAGTGCCCTATACAGG + Intronic
1091700700 12:2659200-2659222 TCATGGTATGTGCCCTCTACAGG + Intronic
1091812627 12:3412278-3412300 TCATGGTAAGTGCCCTGTACAGG - Intronic
1091984553 12:4897979-4898001 TCATGGTAAGTGCCCTATACAGG - Intergenic
1093058781 12:14581353-14581375 TCATGGGAAGTGCCCTATACAGG - Intergenic
1093122644 12:15291204-15291226 TTATAGTAAGTGCCCTATACAGG - Intronic
1093173750 12:15887511-15887533 TCACAGTAAGAGCCCTAAAATGG - Intronic
1093680834 12:22000680-22000702 TCATGGTAAGTGCCCTCTACAGG - Intergenic
1093904117 12:24669521-24669543 TCACGGTAAGTACCCTATACAGG + Intergenic
1093983967 12:25507521-25507543 CCACCCAAAGTGCCCTGTACTGG - Intronic
1094112215 12:26873889-26873911 TCACAGTGAATGCCCTAGACCGG + Intergenic
1094442698 12:30496809-30496831 TCATGGTAAGTGCCCTATATAGG + Intergenic
1094446579 12:30537357-30537379 TCATGTTACGTGCCCTGTACAGG - Intergenic
1094459420 12:30678331-30678353 TCATGGTAAGTACCCTATACAGG + Intronic
1094611092 12:31996359-31996381 TCATATTAAGTGCCCAATACAGG - Intergenic
1095282895 12:40376755-40376777 TTATGGTAAGTGCCCTATACTGG + Intergenic
1095381735 12:41602864-41602886 TCATGGTAAATGCCCTATACAGG - Intergenic
1095822754 12:46497272-46497294 TCATGGTAAATGCCCTATACAGG + Intergenic
1096143161 12:49259147-49259169 TCATGGTAAGTGCCCTATATAGG + Intronic
1096326703 12:50669218-50669240 ACACAGTAAGTGCCCTAAAAAGG - Intronic
1096369829 12:51059706-51059728 TCACAGTAAAAGCCCAGTAGAGG - Exonic
1096911903 12:54992371-54992393 TCATGGTAAGTGTCCTATACAGG - Intergenic
1096948548 12:55438596-55438618 TCATGGTAAATGCCCTATACAGG + Intergenic
1097592933 12:61593235-61593257 TCATGGTAAGTGCCATATACAGG - Intergenic
1097999817 12:65928313-65928335 CCATGGTAAGTGCCCTATACAGG - Intronic
1098159469 12:67635522-67635544 TCATGGTAAGTGCCCTAAACAGG - Intergenic
1098177887 12:67812125-67812147 TCATGGTAACTGCCCTGTATAGG - Intergenic
1098785873 12:74754522-74754544 TCATGGTAAGTGCCCTATATAGG + Intergenic
1098800255 12:74948310-74948332 TTACAGTAAGTATCCTATACAGG - Intergenic
1099121740 12:78698158-78698180 TCATGGTAAGTGCCCTATACAGG - Intergenic
1099670238 12:85681914-85681936 TCATGGTAAGTGCCTTATACAGG - Intergenic
1100457032 12:94762468-94762490 TCATGGTAAATGCCCTATACAGG + Intergenic
1100692652 12:97055206-97055228 TCATGGTAAGTGTCCTATACAGG + Intergenic
1100705121 12:97192537-97192559 TCATGGAAAGTGCCCTGTACAGG + Intergenic
1100807851 12:98306117-98306139 TCATGGTAAGTGCCCTATACAGG - Intergenic
1100967146 12:100025291-100025313 CCACGGTAAGTGCCCTATACAGG - Intergenic
1101464787 12:104937321-104937343 TCATGGTAAATGCCCTATACAGG + Intronic
1101522759 12:105500214-105500236 TCATGGTAAGTGCCCTATACAGG + Intergenic
1101595105 12:106157389-106157411 TCATGGGAAGTGCCCTATACAGG - Intergenic
1101673085 12:106895019-106895041 TCGTAGTAAGTGCCCTGTACAGG + Intergenic
1102566855 12:113802743-113802765 TCACAGGAAGTGCTCAGAACAGG + Intergenic
1102801206 12:115735893-115735915 TCATGGTAAGCGCCCTATACAGG - Intergenic
1102959519 12:117083666-117083688 TTACACGAAGTGCCCTGAACAGG + Intronic
1103046449 12:117738898-117738920 TCATGGTAAGTGCCCTGCACAGG - Intronic
1103178554 12:118886992-118887014 TCATGGCAAGTGCCCTATACAGG - Intergenic
1103902150 12:124308876-124308898 TCACAGCAAGCACCCTGCACAGG - Intronic
1104420150 12:128628212-128628234 TCACAGTAACAGCCTTGAACCGG + Intronic
1104521336 12:129478164-129478186 TCATGGTAAGTGGCCTATACAGG - Intronic
1104600805 12:130152153-130152175 TCACACCCAGTGCCCTGAACAGG + Intergenic
1105683800 13:22757092-22757114 TCACTGTAAGTGCCCTGTACAGG + Intergenic
1105778818 13:23688570-23688592 TCATGATAAGTGCCCTGTATAGG + Intergenic
1106487311 13:30183343-30183365 TCACGGTAAGTGCCTGATACAGG - Intergenic
1107294727 13:38896786-38896808 TCAGGGTAGGTGCCCTATACAGG - Intergenic
1107334339 13:39338249-39338271 TAATAGTAAGTGCCCTATATGGG + Intergenic
1108420442 13:50243885-50243907 TCATGGTAAGTGCCCTATACAGG + Intronic
1108531069 13:51327908-51327930 GCATGGTAAGTGCCCTATACAGG + Intergenic
1108567486 13:51715042-51715064 TCATGGTAAGTGCCCTATCCAGG - Intronic
1108583438 13:51847015-51847037 TCATGGTAAATGCCCTATACAGG + Intergenic
1108825132 13:54404138-54404160 TCATGGTAAGTGCCCTATACAGG - Intergenic
1109454202 13:62562373-62562395 CCATAGTAAGTGCCTTATACAGG + Intergenic
1109660689 13:65456665-65456687 TCATGCTAAGTGCCCTATACGGG - Intergenic
1110232490 13:73181485-73181507 TCATGGTAAGTGCCCTATATAGG + Intergenic
1110271683 13:73598293-73598315 TCACGGTAAGGGCCCTATATGGG + Intergenic
1110836228 13:80086603-80086625 TCCCAGTAAGTGTCCTATATAGG - Intergenic
1110850852 13:80242957-80242979 TCATGGTAAGTGCCCTACACAGG + Intergenic
1111053531 13:82917954-82917976 TCATGGTAAGTGCCCTATACAGG + Intergenic
1111289891 13:86152493-86152515 TCATCATAAGTGCCCTATACAGG - Intergenic
1111349167 13:87003522-87003544 TCATGGTAAGTGCCCTACACAGG + Intergenic
1111370999 13:87316528-87316550 TCATGGTAAGTGCCTTATACAGG + Intergenic
1112289110 13:98129285-98129307 TCATGGTAAGTGCCCTCTGCAGG + Intergenic
1112451403 13:99514312-99514334 TCATGGTAAGTGCCCTATGCAGG + Intronic
1112819591 13:103315842-103315864 TCAGAGTAAGTGAGCAGTACTGG + Intergenic
1112946170 13:104929785-104929807 CAACGGTAAGTGCCCTATACAGG - Intergenic
1113137085 13:107103332-107103354 TCATTGTGAGTGCCCTTTACAGG + Intergenic
1113529426 13:111010720-111010742 TCAGGGTAAGTGCCTTATACAGG + Intergenic
1113748738 13:112764330-112764352 TCACAGACAGTGCACTGTAGTGG + Intronic
1115272811 14:31572980-31573002 TCATGGTAAGTGCCCTATGCAGG - Intronic
1115404934 14:33004465-33004487 TCACAGTAAGTGCCCTATACAGG - Intronic
1115830989 14:37340883-37340905 TCATGGTAAGTGCCCTGTACAGG + Intronic
1115916815 14:38324174-38324196 TCACGGTAACTGCCCCGTAGAGG - Intergenic
1116408015 14:44589311-44589333 TCATGGTAAGTGCCCTAAACAGG - Intergenic
1116692176 14:48122385-48122407 TCACAGTAAGTGCCCTATATAGG - Intergenic
1116740744 14:48751015-48751037 TCATAGTAAGTGCCCTATACAGG + Intergenic
1116843653 14:49844487-49844509 TCATGGTAAGTGCCCTATACAGG - Intronic
1116954844 14:50912985-50913007 TCACAGTGAGTGCCCAGGAGGGG + Intronic
1117456287 14:55900083-55900105 TCACGGTAAGTGCCCTCTACAGG - Intergenic
1117631724 14:57700324-57700346 TCATCGTAAGTGCCCTATACAGG - Intronic
1117863349 14:60117254-60117276 TCATAGTAAGTGCTCTATTCAGG + Intronic
1118698228 14:68406492-68406514 TCATAGTAAGTGCCCTACACAGG - Intronic
1119374114 14:74175050-74175072 TCATGGTAAGTACCCTATACAGG - Intronic
1119403429 14:74379766-74379788 TCATAGTAAGTGCCCTATACAGG + Intergenic
1119474840 14:74921211-74921233 TGACAGGAAGAGCCCTGCACTGG + Intronic
1120408085 14:84114643-84114665 TCATGGTAAGTACCCTATACAGG - Intergenic
1120587392 14:86330003-86330025 TCACTGTAAGTGCCCTATACAGG - Intergenic
1120702396 14:87712562-87712584 GCTCAGTAAGAGCCCTGGACTGG + Intergenic
1120785860 14:88535027-88535049 TCACGGTAAGTACCCTATACAGG + Intronic
1122147578 14:99701340-99701362 TCACAGTAAGTGCCCTATCCAGG + Intronic
1123441251 15:20293615-20293637 TCATGGTAAGTGCCCTATACAGG + Intergenic
1123798047 15:23793637-23793659 TCCCAGCATGTGCCCTGTCCTGG - Intergenic
1123889032 15:24757060-24757082 TTATGGTAAGTGCCCTATACAGG - Intergenic
1123892070 15:24791859-24791881 TCATGATAAGTGCCCTATACAGG - Intergenic
1124259949 15:28180117-28180139 TCATGGTAAGTGCCCTATGCAGG + Intronic
1124449298 15:29771030-29771052 TCATAGTAAGTGCACTAAACAGG + Intronic
1124665869 15:31592051-31592073 TCATGGTAAGTGCCCTGTGCAGG - Intronic
1124982307 15:34577801-34577823 TCATAGAAAGTGCCCTAGACAGG - Intronic
1125057314 15:35376650-35376672 TCATGTTAAGTGCCCTGTACAGG + Intronic
1125067379 15:35504604-35504626 TCTGAGTCAGTGCCCTGTTCTGG - Intronic
1125519916 15:40342652-40342674 TCATGGTAAGTGCCCTATACAGG + Intergenic
1125713008 15:41802184-41802206 TCATGGTAAGTGCCTTATACAGG - Intronic
1125728152 15:41878649-41878671 GCACAGTCAGTGCCCTGTCCTGG + Intronic
1126196834 15:45940797-45940819 TCATGGTAAGTGCCCTCTACAGG - Intergenic
1126477556 15:49081623-49081645 TCATAATAAGTGTCCTATACAGG + Intergenic
1126497146 15:49304273-49304295 TCAAAGTGATTGTCCTGTACTGG + Intronic
1126701984 15:51376378-51376400 TCATGGTAAGTGTCCTATACAGG - Intronic
1127191474 15:56535647-56535669 TCATGGTAAATGCCCTATACAGG + Intergenic
1128297328 15:66534697-66534719 TCATGGTAAGTGCCCTGTACAGG - Intronic
1128493097 15:68170453-68170475 TCATAGTAAGTGCCCCATACAGG - Intronic
1128494517 15:68186669-68186691 TCATGGTAAGTGCCCTATACAGG + Intronic
1129129142 15:73475891-73475913 TCATGGTAAGTGCCCTATACAGG + Intronic
1130156322 15:81353471-81353493 TCATGGTAAGTTCCCTATACAGG + Intronic
1131392409 15:92060100-92060122 TCATGGTAAGTGCCCTCTATAGG - Intronic
1131588335 15:93720307-93720329 TCATAGTAAGTGCCCTAAAAAGG + Intergenic
1132000176 15:98170906-98170928 TCATGGTAAGTGCCCTAGACAGG + Intergenic
1132038341 15:98504720-98504742 TCACAGTAAGTGCCATAAAGAGG + Intronic
1132073902 15:98803362-98803384 TCCTAGTAAGTGCCCTATACAGG - Intronic
1132469398 16:93535-93557 TCACAGAAAGTGCTGTGTGCTGG - Intronic
1133151720 16:3837962-3837984 TCATAGTAAATGCCTTATACAGG + Intronic
1133165172 16:3941561-3941583 TTATGGTAAGTGCCCTATACGGG + Intergenic
1134158145 16:11860907-11860929 TCATGATAAGTGCCCTATACAGG + Intergenic
1136017968 16:27417799-27417821 TCATGGTAAGTGCCCTACACAGG - Intronic
1136719961 16:32311904-32311926 TCATGGTAAGTGCCCTATACAGG - Intergenic
1136725012 16:32350299-32350321 TCGTGGTAAGTGCCCTATACAGG - Intergenic
1136838335 16:33518183-33518205 TCATGGTAAGTGCCCTATACAGG - Intergenic
1136843341 16:33556352-33556374 TCGTGGTAAGTGCCCTATACAGG - Intergenic
1137407369 16:48200246-48200268 TCACAGTCAGAGCCCTGGAAGGG + Intronic
1137636189 16:49988516-49988538 TCTTGGTAAGTGCCCTATACAGG - Intergenic
1138242819 16:55442171-55442193 TCACAGTAAGTGCCCTATACAGG + Intronic
1138281288 16:55773784-55773806 TCACAGACAGGGCACTGTACTGG - Intergenic
1138287251 16:55820077-55820099 TCACAGATAGGGCACTGTACTGG + Intronic
1139057505 16:63203454-63203476 TCATGGTAAGTGCTCTGTACAGG - Intergenic
1139452268 16:67039339-67039361 TCAAAGTAAGTGCCCTATACAGG - Intronic
1141150385 16:81560669-81560691 TCATGGTAAATGCTCTGTACAGG + Intronic
1141321910 16:83018903-83018925 TCGTAGTAAGTGCCCTATACAGG - Intronic
1141543582 16:84746604-84746626 TCACGGTGAGTGCTCTATACAGG - Intronic
1141772274 16:86096531-86096553 TCAGATAAAGTGACCTGTACAGG - Intergenic
1142289419 16:89186092-89186114 GCACAGTAGGTGCTCTGTAAAGG + Intronic
1142289441 16:89186319-89186341 GCACAGTAGGTGCTCTGTAAAGG + Intronic
1142289452 16:89186418-89186440 GCACAGTAGGTGCTCTGTAAAGG + Intronic
1203001418 16_KI270728v1_random:167455-167477 TCGTGGTAAGTGCCCTATACAGG + Intergenic
1203006470 16_KI270728v1_random:205865-205887 TCATGGTAAGTGCCCTATACAGG + Intergenic
1203133021 16_KI270728v1_random:1703859-1703881 TCGTGGTAAGTGCCCTATACAGG + Intergenic
1203148504 16_KI270728v1_random:1818468-1818490 TCATGGTAAGTGCCCTATACAGG - Intergenic
1203153506 16_KI270728v1_random:1856650-1856672 TCGTGGTAAGTGCCCTATACAGG - Intergenic
1143440769 17:6971730-6971752 TCATGGTCAGTGCCCTGTACAGG - Intronic
1144450332 17:15372112-15372134 TCATAGTAAGTGCCCTGTACAGG - Intergenic
1145820864 17:27833937-27833959 TCATGGTACGTGCCCTCTACAGG - Intronic
1146540784 17:33692603-33692625 TCATGGTAAGTACCCTATACAGG - Intronic
1146845238 17:36178291-36178313 TGACTGTAAGTTCCCTGAACTGG - Intronic
1146873452 17:36390134-36390156 TGACTGTAAGTTCCCTGAACTGG - Intronic
1146880813 17:36441222-36441244 TGACTGTAAGTTCCCTGAACTGG - Intergenic
1146934479 17:36804031-36804053 TCTCACTAGGTGCCCTGTATAGG - Intergenic
1147065936 17:37922739-37922761 TGACTGTAAGTTCCCTGAACTGG + Intergenic
1148210893 17:45807891-45807913 TCCCAGTCACTGCCATGTACTGG - Intronic
1148252086 17:46091568-46091590 TCATGGTAAGTGCCCTATACAGG + Intronic
1148368783 17:47077836-47077858 TCATGGTAAGTGCCCTATACAGG + Intergenic
1149261333 17:54883185-54883207 TCATAGTTAGTGCCCTATGCAGG + Intergenic
1149889412 17:60373230-60373252 TCATGGTAAGTGCCCTATATAGG - Intronic
1149905360 17:60521451-60521473 TCACGGTAAGTGCCCTATACAGG + Intronic
1150010937 17:61503099-61503121 TCATGGTAAGTGCCCTACACAGG - Intergenic
1150867856 17:68873132-68873154 TCATGGTAAGTGCCCTATACAGG + Intronic
1151141883 17:72001180-72001202 TCATGGTAAGTGCCTTATACAGG - Intergenic
1151232980 17:72697933-72697955 TCACAGTAAAAGCCTTGTCCAGG + Intronic
1152058947 17:78054192-78054214 TCATGGTAAGTGCCCTATACAGG - Intronic
1153188058 18:2506989-2507011 TCCCACTAAGTGCTCGGTACTGG - Intergenic
1153198655 18:2627682-2627704 TCATGGTAAGTGCCCTATACAGG + Intergenic
1153692896 18:7611407-7611429 TCATGGTAACTGCCCTATACAGG + Intronic
1154270721 18:12916592-12916614 TCATGGTAACTGCCCTATACAGG + Intronic
1155410360 18:25537560-25537582 TCATAGTAAGTGCCCTATACAGG - Intergenic
1155439714 18:25849685-25849707 TCAAGGTAAGTGCCCTATATAGG + Intergenic
1156249855 18:35342513-35342535 TCATGGTAAGTGCCCTGTACAGG + Intronic
1156284101 18:35674104-35674126 TCATGGTAAGTGCCCTATACAGG - Intronic
1156355542 18:36337340-36337362 TCACAGTGATAGCCCTGCACTGG + Intronic
1156382868 18:36579734-36579756 TCACAGTCAGTGCCTTGATCTGG + Intronic
1156405704 18:36780796-36780818 TCATAATAAGTGCCCTATAGAGG - Intronic
1156729053 18:40167891-40167913 TCATGGTAAGTTCCCTGTACAGG + Intergenic
1156826605 18:41437006-41437028 TCACAGTAAGTGCCCTATAAAGG + Intergenic
1157717436 18:49897923-49897945 TCATGGTAAGTGCCCTATACGGG + Intronic
1157782566 18:50452955-50452977 TCATGTTAAGTACCCTGTACAGG + Intergenic
1158665279 18:59427227-59427249 TCATAGTAAGTGCCATATACAGG - Intergenic
1158985149 18:62807802-62807824 TCACAGTAAGTACCCTAGAGAGG - Intronic
1159166739 18:64712041-64712063 TCATGGTAAGTGCCATATACAGG + Intergenic
1159187249 18:64991339-64991361 TCATTGTAAGTTCCCTATACCGG + Intergenic
1159879802 18:73847841-73847863 TCACAGTAAGTGCCCTAGACAGG + Intergenic
1165671477 19:37683157-37683179 TCATGGTAAATGCCCTGTACAGG + Intronic
1165699079 19:37923511-37923533 CCACGGTAAGTGCCCTGTACAGG - Intronic
1166941608 19:46369960-46369982 TCATGGTAAGTGCCCTAAACAGG - Intronic
1167865931 19:52327899-52327921 TCATGGTAAGTGCCCTATATAGG - Intergenic
925006275 2:445221-445243 TCACGGTACATGCCCTGCACAGG + Intergenic
925029498 2:638236-638258 TCGTGGTAAGTGCCCTATACAGG - Intergenic
925600197 2:5600508-5600530 TCACGGCAAGTGTCCTATACAGG - Intergenic
926071086 2:9892082-9892104 TCATGGTAAGTGCCCTATAGAGG + Intronic
926201917 2:10806729-10806751 TCACGGTAAATGTCCTGTACAGG + Intronic
928132580 2:28663524-28663546 TCACAACAAGTGCACAGTACAGG + Intergenic
928355379 2:30608518-30608540 TCATGGTAAGTGCCCTGTAGAGG + Intronic
928933266 2:36647608-36647630 TCATGGTAAGTGCCCTATACAGG + Intergenic
929164453 2:38867007-38867029 TCACGGTAAGTGCCCTACATAGG + Intronic
929240052 2:39644755-39644777 TCATGGTAAGTGCCCTATATAGG - Intergenic
929253826 2:39788177-39788199 TCATGGCAAGTGCCCTATACAGG + Intergenic
929514166 2:42591306-42591328 TCATGGTAAGTGCCCTACACAGG - Intronic
929985676 2:46729621-46729643 TCAAAACAAGTGCCCTATACAGG - Intronic
930169710 2:48238580-48238602 TCATAGTAAGTGTCCTATACTGG + Intergenic
930181489 2:48363589-48363611 TCATGGTAAGTACCCTATACAGG + Intronic
930182792 2:48381358-48381380 TCATGGTAAGTGCCCTATACAGG - Intergenic
930404476 2:50938091-50938113 TCATGGTAAGTGCCCTGCACAGG - Intronic
930652972 2:53980725-53980747 TCATGGTAAGCGCCCTGTATAGG + Intronic
931949565 2:67347158-67347180 TCATGGTAATTGCCCTGCACAGG - Intergenic
932031550 2:68191434-68191456 TCATGGTAAATGCCCTATACAGG - Intronic
932444844 2:71772738-71772760 TCATGGTAAGTGTCCTCTACAGG + Intergenic
932587228 2:73038327-73038349 TCATGGTAAGTGCCCTATGCAGG - Intronic
932920324 2:75906350-75906372 TCATGGTAAGTGCCCTGTACAGG - Intergenic
933374124 2:81457471-81457493 TCATGGTAAGTGCCCTATACTGG + Intergenic
933562248 2:83902520-83902542 TCATAGTAAGTGCCTTATCCAGG + Intergenic
933947776 2:87301607-87301629 CCAAAGAAAGTGCCCTGGACTGG - Intergenic
934321166 2:91973366-91973388 TCATGGTAAGTGCCCTATACAGG + Intergenic
934544583 2:95204277-95204299 TCATGGTAAGTGCCCTATACAGG + Intergenic
934962854 2:98692583-98692605 TCATGGTAAGTGCTCTCTACAGG + Intronic
935178123 2:100667170-100667192 TTACGGTAAGTGCCCTATACAGG + Intergenic
935221231 2:101015260-101015282 TCATAGTAAGTGGTCTATACAGG - Intronic
935400462 2:102654958-102654980 TTATAGTAAGTGCCTTATACAGG - Intronic
935423631 2:102896566-102896588 GCATAGTAAGTGCCCTATACAGG + Intergenic
935644437 2:105322492-105322514 TCACAGTAAGTGCCCCATACAGG + Intronic
935716208 2:105941130-105941152 TCATGGTAAGTGCCCTATACAGG - Intergenic
936233964 2:110727224-110727246 TCATGGAAAGTGTCCTGTACAGG - Intergenic
936288849 2:111202355-111202377 TCATGGTAAGTGCCCTGTACAGG - Intergenic
936332160 2:111556938-111556960 ACACAGTAAGTGTCCTGGATGGG - Intergenic
936332424 2:111559966-111559988 CCAAAGAAAGTGCCCTGGACTGG + Intergenic
936339686 2:111620199-111620221 TCATGGGAAGTGCCCTATACAGG + Intergenic
936579631 2:113686753-113686775 TCATGGTAAGTGCTCTATACAGG + Intergenic
937121225 2:119441153-119441175 TCTCAGTCACTGCCCTGTTCTGG - Intronic
937431155 2:121839782-121839804 TCATGGCAAGTGCCCTCTACAGG + Intergenic
937704899 2:124909182-124909204 TCATGATAAGTGCCCTGTGCAGG + Intronic
937781047 2:125837572-125837594 TCACAGAAAGTGCCATGTTTTGG + Intergenic
939144220 2:138393126-138393148 TCACGGTAAGTGCCCTGTACAGG + Intergenic
939719951 2:145635976-145635998 TCATGGTAAGTGCCCTATACAGG + Intergenic
940022979 2:149175382-149175404 TCATGGTAAATGCCCTATACAGG - Intronic
940066041 2:149630839-149630861 TCATGGTAAGTGCACTGTACAGG - Intergenic
940262268 2:151793640-151793662 TCACATTAAGTGCCTTATACAGG - Intronic
940354723 2:152727573-152727595 TCATTGTAAGTACCCTATACAGG + Intronic
940371408 2:152905210-152905232 TCACAGTTGGTGCCCTCTATGGG + Intergenic
941011509 2:160305301-160305323 TCATGGTAAGTGCCCTATAAGGG + Intronic
941094983 2:161228748-161228770 TCACGGTAAGTGCTCTATACAGG + Intronic
941133906 2:161689328-161689350 TCACAGCAAGTGCTCTATATGGG + Intronic
942151408 2:173079303-173079325 TCATGGTAAATGCCCTATACGGG - Intronic
944009911 2:194962504-194962526 TCACGGTAAATGCCCTATATAGG + Intergenic
944037929 2:195319201-195319223 TCATGGTAAGTGCCCTATAGAGG - Intergenic
944722256 2:202435690-202435712 TCATGGTAAGTGCCCTATACAGG + Intronic
945292417 2:208139050-208139072 TCATGGTAAGTGTCCTATACAGG - Intergenic
945822128 2:214676829-214676851 TTATAGTAAGTGCCCTATACAGG - Intergenic
947835677 2:233173240-233173262 TCATGGTAAGTGCCCTATACAGG - Intronic
947861673 2:233363671-233363693 TTACGGTAAGTACCCTATACAGG + Intronic
948336921 2:237216326-237216348 TCATGGTAAGTGCCCTATACAGG + Intergenic
1168995717 20:2131501-2131523 TCATAGTAAGTGCCCTATATAGG - Intronic
1169181230 20:3569458-3569480 TCATAGTAAGTGGCCTGTACAGG - Intronic
1169846398 20:9997080-9997102 TCATGGTAAGTGCTCTTTACTGG - Intronic
1170120385 20:12905465-12905487 TCATGGTAAGTGCCCTACACAGG + Intergenic
1170659042 20:18318233-18318255 TTATGGTAAGTGCCCTCTACAGG + Intergenic
1170751871 20:19155807-19155829 TCACGGTAAGTGCCCTATACAGG - Intergenic
1170881576 20:20301177-20301199 TCACGGTAAGTACCCTATACAGG + Intronic
1171039332 20:21745302-21745324 TCATGGTAGGTGCCCTATACAGG - Intergenic
1173266799 20:41490980-41491002 TCATGGTAAGTCCCCTGTATAGG - Intronic
1173327165 20:42044483-42044505 TCACAGGAATTGCCCAGTAAAGG + Intergenic
1174305769 20:49613322-49613344 TCACAGTCATTGCCCTGTGTAGG - Intergenic
1175582273 20:60109645-60109667 TCATAGTAAGTGCCCTATACAGG + Intergenic
1175652998 20:60744662-60744684 TCATGGTAAATGCCCTATACAGG + Intergenic
1176067923 20:63209126-63209148 TCACCGTAAGTGCTCTGTACAGG - Intronic
1176938159 21:14890532-14890554 TCATGGTAAATGCCCTTTACAGG - Intergenic
1177572336 21:22903407-22903429 TCATGGTAAGTGCCCTATACAGG + Intergenic
1178613433 21:34108240-34108262 TCATGGTAAGTGCCCTTTATGGG + Intronic
1178728737 21:35079520-35079542 TCATGGTAATTGCCCTATACAGG + Intronic
1178946853 21:36955811-36955833 TCATAGCAAGTGCCCTAGACAGG + Intronic
1179115292 21:38485875-38485897 TCATGGTAAGTGCCTTATACAGG + Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1179410356 21:41157959-41157981 CCACAGTAAGTGCCCTACACGGG + Intergenic
1180109172 21:45640016-45640038 TTCCAGGAAGTGCCCTGTTCTGG + Intergenic
1180133144 21:45840653-45840675 TCATAATAAGTGCCCTAGACAGG + Intronic
1180309410 22:11157338-11157360 TCATGGTAAGTGCCCTATACAGG + Intergenic
1180547887 22:16519149-16519171 TCATGGTAAGTGCCCTATACAGG + Intergenic
1182879249 22:33719459-33719481 TCATGGTAAGTGCCCTATACAGG + Intronic
1182979804 22:34658236-34658258 TCACGGTAAGTGCTCTGTAGAGG - Intergenic
1183112603 22:35661687-35661709 TCGTAGTAAGTGCCCTGTACAGG - Exonic
950277963 3:11679987-11680009 TCATGGTAAGTGCCCTATACAGG + Intronic
950638285 3:14331413-14331435 TCATGGTAAGGGCCCTGTACAGG - Intergenic
951036430 3:17937888-17937910 TCAGAGTAGCTTCCCTGTACTGG + Intronic
952100133 3:30001203-30001225 TCACAGTATATTCCCTCTACTGG - Intronic
952103960 3:30048596-30048618 TCACATGAAGTTGCCTGTACAGG - Intergenic
952906137 3:38140246-38140268 TCAGAGAAAGTGCCCTTTCCAGG - Intronic
953223353 3:40994756-40994778 TCATGGTAAGTGCCCTATATAGG - Intergenic
953281767 3:41564913-41564935 CCATATTAAGTGCCCTATACAGG + Intronic
953895627 3:46797440-46797462 TCATGGTAAGTGCCCTATACAGG + Intronic
954221494 3:49157502-49157524 TCATGGTAAGTGCCCTATACAGG + Intergenic
954585079 3:51727118-51727140 TCATAGTAAGTGCCCTACACAGG + Intergenic
954841233 3:53513762-53513784 TCATGGTGAGTGCCCTCTACAGG + Intronic
954975877 3:54694115-54694137 TCATGGTGAGTGCCCTATACAGG + Intronic
955133637 3:56194501-56194523 TCATGGTAAGTGCCCTGTATAGG - Intronic
955308153 3:57855421-57855443 GCATGGTAAGTGCCTTGTACAGG - Intronic
955540123 3:59966695-59966717 TCATGGTAAGTGCCCTATATAGG - Intronic
955578382 3:60391530-60391552 CCATGGTAAGTGCCCTGTACAGG + Intronic
956056579 3:65304947-65304969 TCATGGTAAGTGCCCTATACAGG - Intergenic
956139693 3:66133288-66133310 TCATGGTAAGTACCCTATACAGG + Intergenic
956713011 3:72054930-72054952 TCATGGTAAGGGCCCTATACGGG + Intergenic
956783873 3:72626090-72626112 TCATGGTAAGTCCCCTATACAGG - Intergenic
956895983 3:73660295-73660317 TCGTGGTAAGTGCCCTATACAGG - Intergenic
956955261 3:74331185-74331207 TCACAGTAAGTGCCCTATACAGG + Intronic
956996718 3:74834059-74834081 TCATAGTAAATGCCCTATGCAGG - Intergenic
957276866 3:78101510-78101532 TCATCTTCAGTGCCCTGTACGGG + Intergenic
957403211 3:79743387-79743409 TCATGGTAAGTGCCTTATACTGG - Intronic
957652463 3:83025606-83025628 TCATGGTAAGTGCCCTATATAGG + Intergenic
958186549 3:90128011-90128033 TCATAGAAAGTGCCCTATACAGG + Intergenic
958451088 3:94273471-94273493 TTACGGTAAGTGCCCTATACAGG - Intergenic
958693595 3:97499752-97499774 TCACGATAAGTGCCCTACACAGG - Intronic
959251349 3:103951643-103951665 TCAGTGTAAGTGCCCTACACAGG + Intergenic
959642123 3:108652704-108652726 TCATGGTAAATGCCCTATACAGG + Intronic
959652508 3:108764872-108764894 TCATGGTAAGTGCCCTCTACAGG - Intergenic
959708976 3:109365619-109365641 TCAGGGTAAGTGCCCTATATAGG - Intergenic
959845941 3:111033705-111033727 TCATGGTAAGAGCCCTATACAGG + Intergenic
960135948 3:114105348-114105370 TCATAGTAAGTGCCCTAAACAGG + Intergenic
960177059 3:114530234-114530256 TCATTGTAAGTGCCCTATAAAGG + Intronic
960458840 3:117907857-117907879 TCATGGTAAGTGCCCTATATAGG + Intergenic
960601801 3:119466415-119466437 TCATGGTAAGTGCCTTATACAGG + Intronic
961204515 3:125070672-125070694 TTACGGTAAGCGCCCTGTACAGG - Intergenic
961528146 3:127521258-127521280 TCATGGTAACTGCCCTATACAGG + Intergenic
962441389 3:135420827-135420849 TCATGGTAAGTGCCCTATAGAGG - Intergenic
962480397 3:135793072-135793094 GCACTGTAAGGGCCCTGTACAGG - Intergenic
962968591 3:140377916-140377938 TCATGGTAAGTGCCCTGTACAGG + Intronic
963134953 3:141894130-141894152 TCAAGGTCAGTGCCCTATACAGG - Intronic
963216184 3:142751268-142751290 TGATGGTAAATGCCCTGTACAGG + Intronic
963875533 3:150470524-150470546 TCATGGTAAGTGCCCTATACAGG - Intergenic
964127700 3:153253102-153253124 TAATGGTAAGTGCCATGTACAGG - Intergenic
964423178 3:156526038-156526060 TCATGGTAAGTGCCCTACACAGG + Intronic
964749935 3:160045096-160045118 TCATGGTAAGTGCTCTCTACAGG + Intergenic
964965516 3:162487639-162487661 TCATGGTAAGTGCCCTATATAGG - Intergenic
965331877 3:167385370-167385392 TTACGGTAAGTGCCCTATATAGG - Intergenic
965364953 3:167786555-167786577 TCATAGTAAGTGTCCTTTACAGG - Intronic
965557630 3:170034384-170034406 TCATGGTAAGTGCTCTATACGGG - Intergenic
966025010 3:175268353-175268375 TGACGCTAAGTGCCCTATACAGG - Intronic
966240499 3:177750697-177750719 TCATGGTAAGTGCCCTATACAGG + Intergenic
966343219 3:178948689-178948711 TCACAGTAAGTGCTCTATACAGG - Intergenic
966418183 3:179710920-179710942 TCACGGTAAGTGCCCTGTACAGG - Intronic
966499101 3:180617951-180617973 TTATGGTAAGTGCCCTGTACAGG + Intronic
966628054 3:182040484-182040506 TCATGGTAAGTGCCCTATACAGG - Intergenic
967127675 3:186439442-186439464 TCATGGTAAGTGCCTTCTACAGG - Intergenic
967250960 3:187537398-187537420 ACATAGTAAGCGCCCTGTACAGG - Intergenic
967938977 3:194751734-194751756 TCATGGTAAATGCGCTGTACAGG - Intergenic
969928294 4:10605879-10605901 TCATGGTAAGTGCCTTATACAGG - Intronic
970396488 4:15672590-15672612 TCATGGTAAGTGCCCTTTACAGG - Intronic
970634882 4:17998165-17998187 TCATGGTAAGTGCCCTATACAGG - Intronic
970889030 4:21021240-21021262 TCACAGTAAATGTGCTATACAGG - Intronic
970890378 4:21037348-21037370 TCATAGTAAGTGCCCTGCATAGG + Intronic
970984242 4:22137046-22137068 TCATGGTAAGTGCCCTATTCAGG - Intergenic
971217065 4:24671650-24671672 TCACAGCCACTGCCCTATACTGG + Intergenic
971731365 4:30386471-30386493 TCATAGTAAGTGCCCTATACAGG + Intergenic
971791524 4:31175491-31175513 TCATGGTAAGTGCCCTATGCAGG + Intergenic
972001308 4:34038857-34038879 TCATGGTAAGTGCCCTATACAGG - Intergenic
972452655 4:39218520-39218542 TCATGGTAAGTGCCCTATACAGG - Intronic
972748699 4:41967369-41967391 TCATGTTAAGTGCCCTATACAGG + Intergenic
972820461 4:42696065-42696087 TCATGGTGAGTGCCCTATACAGG - Intergenic
972852273 4:43065302-43065324 TCATAGTAAGTACCCTATACAGG + Intergenic
972926719 4:44017366-44017388 TCACAGTAAGTACCTTATACAGG + Intergenic
973562053 4:52146867-52146889 TCATGCTAAGTGCCCTATACAGG + Intergenic
973725259 4:53769361-53769383 TCATGGTAAATGCCCTATACCGG + Intronic
973900922 4:55470215-55470237 TCATGGTGAGTGCCCTATACAGG + Intronic
973929023 4:55770646-55770668 TCATAGTAAGTGCCCTATACAGG + Intergenic
974191005 4:58503889-58503911 TCATGGTAAGTGCCCTATATAGG - Intergenic
974362821 4:60904256-60904278 TCATGGTAAATGCCCTATACAGG + Intergenic
974858032 4:67484102-67484124 TCATGGTAAGTGCCCTATAAGGG + Intronic
975452864 4:74550248-74550270 TCATGGTAAGTGCTCTGTATGGG + Intergenic
975667566 4:76748067-76748089 ACACAGTAAATACCCAGTACCGG + Intronic
976038122 4:80848831-80848853 TCATGGTAAGTGCCTTATACAGG - Intronic
976269266 4:83214511-83214533 TTACAGTAAGTGCCCTATATAGG - Intergenic
976799841 4:88976763-88976785 TCAGGGTAAGTGCCCTACACAGG + Intronic
976803197 4:89016555-89016577 TCATGGTAAATGCCCTATACAGG + Intronic
976887011 4:89998142-89998164 TCACAGTAAATGACCCGTATAGG + Intergenic
977007694 4:91592021-91592043 TCTCAGTAAATGCCAGGTACTGG + Intronic
977192206 4:94015125-94015147 TCATGCTAAGTGCCCTATACAGG - Intergenic
977299230 4:95248971-95248993 TCATAGTAAGTGCCCTATACAGG + Intronic
977437723 4:97020813-97020835 TCACATTAAGTGCCCTATACAGG - Intergenic
977498315 4:97804746-97804768 TCACAGTAAGTGCCCTATACAGG + Intronic
977741580 4:100490523-100490545 TCATGGTAAGTGCCCTATACAGG + Intronic
977831723 4:101602368-101602390 TCATGATAAGTGCCCTCTACAGG + Intronic
978429036 4:108613832-108613854 TTATAGTCAGTGCCCTATACAGG + Intergenic
978554752 4:109967927-109967949 TCATGGTAAGTGCCCTATAAAGG - Intronic
978640042 4:110859590-110859612 GCATGGTAAGTGCCCTATACAGG - Intergenic
979188395 4:117827785-117827807 TCATGGTAGGTGCCCTATACAGG - Intergenic
980011078 4:127595321-127595343 TCATAGTGAATGCCCTATACAGG + Intergenic
980408828 4:132388582-132388604 TCATGGTAAGTGCCCTATACAGG + Intergenic
980510249 4:133776027-133776049 TCATAGTAAGTGCTCTGTGTAGG - Intergenic
981041050 4:140222298-140222320 TCAGAATAAGTGCCCTATGCAGG - Intergenic
981222435 4:142253153-142253175 TCATGGTAAATGCCCTTTACAGG - Intronic
981274070 4:142877117-142877139 TTAGAGTAAGTGCCATGTAGTGG - Intergenic
981604183 4:146524817-146524839 TCATAGTAAGTGCTCTATACAGG - Intergenic
981676457 4:147348631-147348653 TCATGGTAAGTGCCCTATAGAGG + Intergenic
981790443 4:148530346-148530368 TCATAATAAGTGACCTATACAGG + Intergenic
981798852 4:148632608-148632630 TCATGGTAAGTGCCCTATATAGG - Intergenic
981943208 4:150309064-150309086 TCATGGGAAGTGCCCTATACAGG + Intronic
982027728 4:151268284-151268306 TCACAGTAAGTGCCCTATATAGG - Intronic
982153178 4:152486139-152486161 TCATAGTAAGTGCCCTATATAGG - Intronic
982345774 4:154356552-154356574 TCATAATCAGTGCCCTATACAGG + Intronic
982422567 4:155214361-155214383 TGACAGTAATTGCCCTGGACCGG + Exonic
982802364 4:159721116-159721138 TCATGGTAAGTGCCCTATATGGG - Intergenic
982905440 4:161063625-161063647 TCATGGTAAGTGCCCTACACAGG - Intergenic
983098770 4:163598652-163598674 TCATGGTAAGTGCACTATACAGG - Intronic
983260121 4:165447126-165447148 TCATGGTAAGTGCCCTATACAGG - Intronic
983422341 4:167535224-167535246 TCATGGTAAGTGCCTTATACAGG + Intergenic
983474832 4:168201020-168201042 TCACGGTAAGTGCCCTATATAGG - Intergenic
984046674 4:174809088-174809110 TCATCGTAAGTGCTCTATACAGG + Intronic
984080247 4:175239065-175239087 TCATGGTAAGTGCCCTATAAAGG + Intergenic
984234492 4:177139453-177139475 TTATGGTAGGTGCCCTGTACAGG - Intergenic
984282044 4:177682165-177682187 TCATGGTAAGTGCCCTGTCCAGG + Intergenic
985235921 4:187873947-187873969 TCACGGTAAGTGCCCTATGCAGG - Intergenic
985928843 5:3039538-3039560 TCACGATGAGTGCCCTGTACAGG + Intergenic
985941131 5:3137079-3137101 TCATGGCAAGTGCCCTATACAGG - Intergenic
986285789 5:6357812-6357834 TCATAGTAAGTGCCCTGTACAGG + Intergenic
987151219 5:15042324-15042346 TCATGGTAAGTGCTCTATACAGG - Intergenic
987480240 5:18446489-18446511 TCATGGTAAGTGCCCTGTAGAGG - Intergenic
987519862 5:18967777-18967799 TCATGGTAAGTGACCTGTACAGG - Intergenic
987853808 5:23391797-23391819 TCATAGTAAGTGCCTTATACAGG - Intergenic
987857216 5:23436260-23436282 TCACAGTAAGTGCCCTGTACAGG + Intergenic
988170378 5:27646694-27646716 TCATAGTGAGTGCTCTATACAGG - Intergenic
988661467 5:33274384-33274406 TCATGGTAAGTGCCCTATACAGG - Intergenic
988842902 5:35100419-35100441 TCATGGTAAGTACCCTTTACAGG + Intronic
988935070 5:36073761-36073783 TTACATTAAGTGCCATCTACTGG - Intergenic
989082028 5:37632897-37632919 TCGTGGTAAGTGCCCTATACAGG + Intronic
989175328 5:38519289-38519311 TCACGGTAAGTGCCTTATACAGG + Intronic
989683350 5:44055697-44055719 TCATGGTAAGTGCCTTATACAGG + Intergenic
990313570 5:54563327-54563349 TCATGGTAAGTGCCCTATATGGG + Intergenic
990640176 5:57774494-57774516 TCATGGTAAGTGCTCTGTATAGG - Intergenic
991400783 5:66249301-66249323 TCCTGGTAAGTGCCCTGTACAGG - Intergenic
992065291 5:73102012-73102034 TCATGGTGAGTGCCCTATACAGG - Intergenic
993369701 5:87077171-87077193 TCATGGTAAGTGCCCTAAACAGG + Intergenic
993374405 5:87133118-87133140 TCATGGTAAGTGCCCTATATAGG - Intergenic
993853419 5:93039941-93039963 TCACAGTAAGTACCCTATACAGG + Intergenic
993894268 5:93512647-93512669 TCACAGTAAGTGCCCTATATAGG + Intergenic
993954871 5:94219778-94219800 TCATGGTAAGTGCCCTATAAAGG - Intronic
994018816 5:95000888-95000910 TCATGGTAAATGCCCTATACAGG + Intronic
994299445 5:98129367-98129389 TCACGGTAAATGCCCTATACAGG - Intergenic
994585247 5:101700013-101700035 TCATGGTAAGTGCCCTACACAGG + Intergenic
994687863 5:102978848-102978870 TCAAAGTAAGTGCTATGTATAGG - Intronic
994820060 5:104637756-104637778 TCATGGTAAGTGTCCTATACAGG + Intergenic
995354363 5:111222138-111222160 TCATGGTAAGTGCCCTATACAGG + Intergenic
995754036 5:115483530-115483552 TCATGGTAAGTGCCCTATATAGG + Intergenic
996436611 5:123440165-123440187 TCACGGTAAGTGCCCTAAATAGG - Intergenic
998067023 5:139167813-139167835 TCATGTTAAGTGCACTGTACAGG + Intronic
998791541 5:145771093-145771115 TCACAGTAAGTGTCCTATACAGG + Intronic
999466649 5:151812916-151812938 TCTCCGTAAGTGGCCTGTCCTGG + Intergenic
999629627 5:153557093-153557115 TCATGGTAAGTGCCTTATACAGG - Intronic
999664495 5:153898468-153898490 TCACAAAAACTGCCCTGCACTGG + Intergenic
999883808 5:155897316-155897338 TCATGGTAAGTGCCCTAGACAGG - Intronic
1001078516 5:168648807-168648829 TCACGGTAAGTTCCCTATATAGG + Intergenic
1001225208 5:169938568-169938590 TCATGGCAAGTGTCCTGTACAGG - Intronic
1001609157 5:172986073-172986095 TCATGGTAAGTGCCCTACACAGG - Intronic
1002763967 6:223958-223980 TCATGGTAAGTGCCTTGCACAGG - Intergenic
1002868315 6:1143884-1143906 TCACGGTAAGGGCCCTGACCTGG + Intergenic
1003235439 6:4291403-4291425 TCATTGTAAGGGCCCTATACAGG + Intergenic
1003672491 6:8172236-8172258 TCATGGTAAGTGCCCTCTACGGG - Intergenic
1004050134 6:12069311-12069333 TCATGGTAAGTGTCCTATACAGG - Intronic
1004174744 6:13329721-13329743 ACACAGTAAGTGCCCAGCCCTGG - Intergenic
1004262751 6:14122493-14122515 GCACAGTAAGTGTTCAGTACTGG - Intronic
1004524773 6:16396750-16396772 TCATGGTAAGTGCCCTATATAGG + Intronic
1004540840 6:16548252-16548274 TCATGGGAAGTGCCCTATACAGG - Intronic
1004578512 6:16923908-16923930 TCATAGTAAGTGCCCTTTACAGG - Intergenic
1004587734 6:17018677-17018699 TCACGGTAAGTGCCTTATACAGG + Intergenic
1004898757 6:20174500-20174522 TCATGGTAAATGCCCTGGACAGG - Intronic
1005105107 6:22215698-22215720 TCATGGTAAGTGCCCTACACAGG + Intergenic
1005811682 6:29520768-29520790 TTACAGTGAGAGCCCTGTATAGG - Intergenic
1005969118 6:30747559-30747581 TCAGAGTAAGTTTCCTGTAACGG + Intergenic
1006998670 6:38287267-38287289 TCATGGTAAGTGCCCTACACAGG + Intronic
1007127420 6:39438847-39438869 TCATGGTAACTGCCCTGTACAGG + Intronic
1007559193 6:42792063-42792085 TCATGGTAACTGCCCTATACAGG - Intronic
1007672050 6:43563776-43563798 TCATGGTAAGTGCCTTCTACAGG - Intronic
1007806466 6:44453282-44453304 TCATGCTAAGTGCCCTATACAGG - Intergenic
1008067600 6:47066654-47066676 TCACAGTAAGTGCCCTACACAGG + Intergenic
1008539937 6:52537777-52537799 ACACAGTAAGTGCTCAGTAACGG + Intronic
1008593930 6:53022314-53022336 TCACAGTAAGTGCCCTATACAGG + Intronic
1008627326 6:53330298-53330320 TCATGGTAAGTGCCCTGTACAGG - Intronic
1008695781 6:54034887-54034909 TCATGGTAAATGCCCTATACAGG + Intronic
1008710353 6:54218389-54218411 TCATGGTAAGTGCACTATACAGG - Intronic
1008772504 6:54995984-54996006 TTATATTAAGTGCCCTTTACAGG + Intergenic
1009594667 6:65718879-65718901 TTATGGTAAGTGCCCTATACAGG + Intergenic
1009949801 6:70382406-70382428 TCATGGTAAGTGCCCTATATAGG + Intergenic
1010588060 6:77679296-77679318 TCATCTTAAGTGCCCTATACAGG + Intergenic
1010946342 6:81977637-81977659 TCATAGTAAGTGTCCTATACAGG - Intergenic
1011856362 6:91697240-91697262 TCATTGTAAGTGCTCTATACAGG + Intergenic
1012114872 6:95284413-95284435 TCATGGTAAGTGCCCTATACAGG + Intergenic
1012266352 6:97148898-97148920 TCACGGTAAGTGCCCTATATAGG + Intronic
1012421604 6:99071846-99071868 TCATAGTAAGTGCCCTGTACAGG - Intergenic
1012534006 6:100273860-100273882 TCATGGTAAGTGCCCTATACAGG + Intergenic
1012827123 6:104160822-104160844 TCATGGTAAGTGCTCTATACAGG - Intergenic
1012839610 6:104312976-104312998 TCCTAGTAAGTGCCCTATACAGG - Intergenic
1012969629 6:105714986-105715008 TCATGGTAAGTGCCCTATAGAGG - Intergenic
1013165641 6:107589330-107589352 TGACAGAAAGTGCCCTGGCCAGG + Intronic
1013238411 6:108220315-108220337 TTATGGTAAGTGCCCTATACAGG + Intronic
1013372944 6:109485755-109485777 TCATGGTAAGTGCCCTACACAGG + Intergenic
1014158670 6:118141173-118141195 TCATGATAAGTGCCCTATACAGG + Intronic
1014218000 6:118771416-118771438 TCAGGGTAAGTGCCCTATACAGG - Intergenic
1014322438 6:119946894-119946916 TCATGGTAAGTGCCCTATACAGG - Intergenic
1014579482 6:123118824-123118846 TCGTAGTAAGTGCCCTATAGAGG + Intergenic
1015608927 6:134992927-134992949 TCATGGTAAGTGCCCTATACAGG + Intronic
1015799468 6:137045536-137045558 TCATGGAAAGTGCCCTATACAGG - Intergenic
1016382105 6:143495071-143495093 TCGTGGTAAGTGCCCTATACAGG + Exonic
1016635884 6:146289663-146289685 TCATAGTAAGTGTCCTGTACAGG + Intronic
1017132991 6:151123895-151123917 TCATGGTGAGTGCCATGTACAGG + Intergenic
1017600940 6:156080618-156080640 TCATAGTAAGTGCCCTATACAGG + Intergenic
1017655915 6:156629718-156629740 TCACGGTAAGTGCCCTATACAGG + Intergenic
1017669599 6:156757239-156757261 TCATGGTAAGTGCCTTATACAGG + Intergenic
1018041643 6:159929394-159929416 TCGTGGTAAGTGCCCTGTACAGG + Intergenic
1018191929 6:161316784-161316806 TCAGAGTAAATGCCCTACACAGG + Intergenic
1018256108 6:161920811-161920833 TCACAGTAAGTGTCCTATTCAGG - Intronic
1018998250 6:168726403-168726425 GAACAGTAAGTGGCCTGTGCTGG + Intergenic
1020209911 7:6151135-6151157 TCATGGTAAGTGCCCTGTGCAGG - Intronic
1020388590 7:7634061-7634083 TTATGGTAAGTGCCCTATACAGG - Intergenic
1020517643 7:9143280-9143302 TCATGGTAAGTGCCCTATACAGG - Intergenic
1020551880 7:9616858-9616880 TCATGGTGAATGCCCTGTACAGG - Intergenic
1020875363 7:13686725-13686747 TAATTGTAAGTGCCCTATACAGG + Intergenic
1021743539 7:23713313-23713335 TCATGGTGAGTGCCCTATACAGG - Intronic
1022087104 7:27078855-27078877 TCATGGTAAGTGTCCTATACAGG + Intergenic
1022666043 7:32411525-32411547 TCACAGTAAGTCCCTTATACAGG - Intergenic
1022940089 7:35227409-35227431 TCACGGTGAGTGCCTTATACAGG + Intronic
1023291583 7:38673655-38673677 TCGTGGTAAGTGCCCTATACAGG + Intergenic
1023763140 7:43485719-43485741 TCACTGTAAGTATCCTATACAGG - Intronic
1023902970 7:44498268-44498290 TAACAGTAAATGGCCTTTACTGG - Intergenic
1024468931 7:49746822-49746844 TCATAGTAAGTGCCCTATATAGG - Intergenic
1026419972 7:70224731-70224753 TCATGGTAAGTGCCCTATACAGG + Intronic
1027330014 7:77082413-77082435 TTATGGTAAGTGCCCTATACAGG + Intergenic
1027341860 7:77217897-77217919 TCACAGTAAGTGCCCTATATAGG - Intronic
1027344576 7:77244453-77244475 TCATGGTAAGTGCCCTAGACAGG + Intronic
1027545766 7:79525466-79525488 TCACAGTAAGTGCCCTACACAGG - Intergenic
1027960160 7:84935782-84935804 TCACAGTAAGTGACTTATAGAGG - Intergenic
1028196965 7:87918662-87918684 TCATAGTAAGTACCCTATATAGG + Intergenic
1028368665 7:90065451-90065473 TCATAATAAGTACTCTGTACAGG + Intergenic
1028495825 7:91459658-91459680 TCATGGTAAGTGCTCTATACAGG - Intergenic
1028601375 7:92604155-92604177 TCAGTGTAAGTGCCCTTTGCAGG + Intergenic
1028636561 7:92995898-92995920 TCATGGTAAGTGTCCTATACAGG - Intergenic
1028757893 7:94458992-94459014 TCATGGTAAGTGCCCTCTACAGG + Intergenic
1029785754 7:102788928-102788950 TTATGGTAAGTGCCCTATACAGG - Intronic
1029914094 7:104188980-104189002 TCACAGTCTGTGGGCTGTACAGG - Intronic
1029957788 7:104657917-104657939 TCACTGTAATTGCTCTCTACTGG - Intronic
1030042579 7:105465295-105465317 TAAAAGTAAGTTCCCTGTATGGG - Exonic
1030471155 7:109963898-109963920 TCATGGTAGGTGCCCTATACAGG - Intergenic
1030707684 7:112711713-112711735 TCATGGTAAGTGCCCTATACAGG + Intergenic
1030767334 7:113427110-113427132 TCATGGTAAGTGCTCTATACAGG + Intergenic
1031091257 7:117357879-117357901 TCATGGTAAGTGTCCTATACAGG + Intergenic
1031157846 7:118131624-118131646 TAACAGTAAGTGCCCTGTATGGG - Intergenic
1031191760 7:118561663-118561685 TCACAGTAAGTAGCCTACACAGG - Intergenic
1031576875 7:123425240-123425262 TCATGGGAAGTGCCCTATACTGG + Intergenic
1031640508 7:124158035-124158057 TCATGGTAATTGCCCTATACAGG - Intergenic
1031674487 7:124591908-124591930 TCATGGTAAATGCCCTATACAGG - Intergenic
1031781983 7:125979674-125979696 TCACAGTAAATGGTATGTACTGG + Intergenic
1032891773 7:136203431-136203453 TCATGGTAAGTGCCCTTTACAGG - Intergenic
1032929538 7:136650563-136650585 TCATGGTAAATGCCCTGTACAGG - Intergenic
1032940918 7:136790342-136790364 TCACATTAAGTGTCCTATTCAGG + Intergenic
1033429593 7:141276961-141276983 TCACGATAAGTGCCCTATACAGG - Intronic
1033784099 7:144709321-144709343 TCACAGTCAGTGCCCTAGACAGG + Intronic
1034057494 7:148050731-148050753 TCATGATAAGTGCCCTATACAGG + Intronic
1034373006 7:150616548-150616570 TTATGGTAAGTGCCCTATACAGG - Intergenic
1034921751 7:155088904-155088926 TCATGGCAAGTACCCTGTACAGG - Intergenic
1035936356 8:3845496-3845518 TCATGGCAAGTACCCTGTACAGG - Intronic
1036083701 8:5589194-5589216 TCATGGTAAGTGCCCTATATGGG - Intergenic
1036445010 8:8813898-8813920 TTATAGTAAGTGCCCTACACAGG + Intronic
1037248424 8:16863754-16863776 TCATGGTAAGTGCCCTATACAGG + Intergenic
1037793590 8:21971002-21971024 TCATGGTAAGCGCCCTATACAGG + Intronic
1037919801 8:22797838-22797860 TCAGAGTGAGTGCCCTGACCAGG + Intronic
1038415788 8:27394476-27394498 TCACTGTAAGTGCCCTAGACCGG - Intronic
1038834379 8:31102651-31102673 TCACAGGAAGCACCCTATACAGG - Intronic
1039116730 8:34099505-34099527 TCATGGTAAGTGCCCTGGACAGG + Intergenic
1039599476 8:38822373-38822395 TCATGGTAAGGGCCCTATACAGG - Intronic
1039833831 8:41239154-41239176 TCACAGTAAGTGTCCTGTACAGG + Intergenic
1040004369 8:42606699-42606721 TCATGGTAAGTGCCCTATAAAGG - Intergenic
1040600301 8:48877506-48877528 TCTCGGTAAGTGCCCTATACAGG + Intergenic
1040837683 8:51749542-51749564 TCAAAGTGAGTGCCCTATGCAGG - Intronic
1040896302 8:52372554-52372576 TCACGGTAAGTGCCCTGTACAGG + Intronic
1041141686 8:54827053-54827075 TTATGGTAAGTGCCCTGTACAGG - Intergenic
1041426929 8:57731937-57731959 TCATGGTAAGTGCCCTATAGAGG - Intergenic
1042296256 8:67221771-67221793 TCATGGTAAGTGCCCTATATGGG + Intronic
1042462743 8:69090078-69090100 TCATGGTAAGTGCTCTATACAGG - Intergenic
1042925079 8:73959084-73959106 TCATCGTGAGTGCCCTATACAGG - Intronic
1043039433 8:75242657-75242679 TCATGGTAAGTGCCCTATAGAGG + Intergenic
1043359477 8:79454655-79454677 TCACGGTAAGTGCCCTATACAGG + Intergenic
1043997334 8:86834326-86834348 TCATGGTAAGTGCCCTCTACAGG - Intergenic
1044116534 8:88342845-88342867 TCAGGGTAAGTGTCCTATACAGG - Intergenic
1044246778 8:89957628-89957650 TCACGGTAAGTGTCTTATACAGG + Intronic
1044414702 8:91924447-91924469 TCATGGTAAGTGGCCTATACAGG + Intergenic
1044518070 8:93162895-93162917 TCGTAGTAAGTGCTCTGTACAGG + Intronic
1044807118 8:96019807-96019829 TCATGGTAAGTGCCCTGTACAGG + Intergenic
1045247156 8:100453071-100453093 TCATGGTAAGTGCCCTATGCAGG - Intergenic
1045484529 8:102620792-102620814 TCAAGGTAAGTGCCCTATACTGG + Intergenic
1045738728 8:105327907-105327929 TAACAGTAAATGCCATGGACTGG + Intronic
1046157432 8:110310981-110311003 TCATGGTAATTGCCCTATACAGG - Intergenic
1046364178 8:113204648-113204670 TCATGGTAAGTGCCCTCTACAGG + Intronic
1046657985 8:116916541-116916563 TTATGGTAAGTGCCCTGTATAGG - Intergenic
1046890082 8:119413306-119413328 TCACGGTAAGTGCCCTACACAGG + Intergenic
1047351103 8:124074956-124074978 TCATGGTAAGTGCCCTAGACAGG - Intronic
1047384707 8:124398117-124398139 TCATAGTAAGTGCTCTGTACAGG - Intergenic
1047548704 8:125846272-125846294 TCATAGTAAGTACCTTATACAGG + Intergenic
1047923606 8:129660040-129660062 TCCTGGTAAGTGCCCTATACTGG - Intergenic
1048557097 8:135489918-135489940 TCATGGTAAGTGCCTTATACAGG + Intronic
1048566808 8:135608942-135608964 TCATGGTAAGTGACCTGTATGGG - Intronic
1048568628 8:135630794-135630816 TCATGGTAAGTGCCTTATACAGG - Intronic
1048761263 8:137798206-137798228 TCACAGTAATTGCTTTTTACAGG - Intergenic
1048761718 8:137802908-137802930 TCATGGTAAGTGCCGTGTATAGG - Intergenic
1049215911 8:141408140-141408162 TCACAGCAAATGTCCTGAACAGG + Intronic
1049811416 8:144575141-144575163 TCCTGGTAAGTGCCCAGTACAGG - Intronic
1050436717 9:5618995-5619017 TCATAGTAAGTGCCTTGTATGGG - Intergenic
1050770564 9:9193705-9193727 TCATGGTAAGTGCCCTACACAGG - Intronic
1051263933 9:15293058-15293080 TCATGGTAAGTGCCCTATACAGG + Intronic
1051647359 9:19281935-19281957 TCATGGTAAGTGCCCTATACAGG - Intronic
1052168868 9:25368964-25368986 TCACAGTAAGTGCCCTACATAGG - Intergenic
1052293930 9:26876533-26876555 TATTGGTAAGTGCCCTGTACAGG + Intronic
1052369983 9:27653480-27653502 TTATGGTAAGTGCCCTGAACAGG + Intergenic
1052729623 9:32269876-32269898 TCATGGTAAGTGCCCTATACAGG + Intergenic
1052953752 9:34235788-34235810 TTATGGTAAGTGCCCTATACAGG + Intronic
1053049570 9:34948450-34948472 TCATGGTAAGTGCCCTATACAGG + Intergenic
1053402728 9:37840812-37840834 TCATGGTAAGTGCCCTATACAGG + Intronic
1055630272 9:78216695-78216717 TCACAGTCAGTGCCCTATACAGG - Intergenic
1056242489 9:84662003-84662025 TCATGGTAAATGCCCTTTACAGG - Intergenic
1056748570 9:89327195-89327217 TCATGGTAAGTGCCCTATACGGG - Intronic
1056804629 9:89718933-89718955 TCACAGCAAGAGGCCTGTGCTGG - Intergenic
1058611649 9:106783343-106783365 TTATGGTAAGTGCCCTATACAGG + Intergenic
1059183353 9:112241465-112241487 TCATAGGAAGTGCCCTATACAGG + Intronic
1059719000 9:116940843-116940865 TCATGGTAAGTGCCCTATACAGG + Intronic
1059872312 9:118591597-118591619 TCATGGTAAGTGCCCTATACAGG + Intergenic
1060081819 9:120655232-120655254 TCATAGTAAGTACCCTAGACAGG + Intronic
1060923959 9:127442467-127442489 TCATGGTAAGTGCCCTATACAGG - Intronic
1061404042 9:130383829-130383851 ACACAGTAAGTGCTCAGTAATGG - Intronic
1062190444 9:135245309-135245331 TCACAGTGATTTCCCTGAACGGG - Intergenic
1186029492 X:5352558-5352580 TCACAGTAACTGCCCTATACAGG - Intergenic
1186033990 X:5400535-5400557 TCATAGTAAGTGCCCTATACAGG + Intergenic
1186310400 X:8311398-8311420 TCATGGTAAATGCCCTATACAGG - Intergenic
1187080316 X:15979399-15979421 TCTTGGTAAGTGCCCTATACAGG + Intergenic
1188084773 X:25890223-25890245 CCACAGTAAGTACCCTATATAGG - Intergenic
1188509062 X:30913969-30913991 TCATGGTAAGTGTCCTATACAGG - Intronic
1188855992 X:35196487-35196509 TCATGGTAAGTGCCCTATACAGG + Intergenic
1189063325 X:37778202-37778224 TCATGGTAAGTGCCTTATACAGG - Intronic
1189158161 X:38781473-38781495 TCATGGTAAGCGCCCTATACAGG - Intergenic
1190150945 X:47947199-47947221 TCATGGTAAGTGCCCTGTACAGG - Intronic
1191135894 X:57064776-57064798 TCATGGCAAGTGCCCTATACAGG + Intergenic
1192344860 X:70293768-70293790 TCACGGTAATTGCCCTATACGGG - Intronic
1192374342 X:70544036-70544058 TCATGGTTAGTGCCCTATACAGG - Intronic
1192407634 X:70902294-70902316 TCATGGTAAGTGCCCTATACAGG - Intronic
1193145386 X:78070718-78070740 TCAAGGTAAGTGCCCTATACAGG - Intronic
1193318322 X:80091226-80091248 TCATGGTAAGTGCTCTATACAGG + Intergenic
1193611574 X:83637850-83637872 TCATGGTAAGTGCCCTAGACAGG - Intergenic
1194473666 X:94332029-94332051 TCAGTGTAAGTGCCCTATAAAGG + Intergenic
1194496700 X:94624821-94624843 TCATAGTAAGTGCCCTATGCAGG - Intergenic
1195296396 X:103482284-103482306 TCATGGTAAGTGCCCTATATAGG - Intergenic
1195501851 X:105611444-105611466 TCATGGTAAATGCCCTATACAGG + Intronic
1195571794 X:106404997-106405019 TTACTGTGAGTGCCCTATACAGG - Intergenic
1195772656 X:108368363-108368385 TCATGGTAAGTGCCCTAGACAGG - Intronic
1195781763 X:108474220-108474242 TCATGGTAAGTGCCCTATACAGG + Intronic
1195872993 X:109505647-109505669 TCATGATAAGTGCCCTATACAGG - Intergenic
1196041390 X:111208454-111208476 TCATAGTGAGTGCCCTACACAGG + Intronic
1196082372 X:111646954-111646976 TTATGGTAAGTGCCCTATACAGG - Intergenic
1196568222 X:117233268-117233290 TCATGGTAAGTGCCCTATATAGG - Intergenic
1196641433 X:118067286-118067308 TCATGCTAAGTGCCCTATACAGG - Intronic
1196894091 X:120316821-120316843 TCATGGTAAGTGCTCTATACAGG + Intergenic
1197047322 X:122013143-122013165 ATACAGTAAGTGCTCTATACAGG + Intergenic
1198650581 X:138859654-138859676 TCCCAGAAAATGCCTTGTACTGG + Intronic
1198884853 X:141323316-141323338 TCATTTTAAGTGCCCTATACAGG - Intergenic
1199373049 X:147073890-147073912 TCATGGTAAGTGCCCTCTACAGG - Intergenic
1200312741 X:155095750-155095772 TCATGGTAAGTGCCCTATACAGG + Intronic
1201188656 Y:11428488-11428510 TCATGGTAAGTGCCCTATACAGG + Intergenic
1201557208 Y:15275189-15275211 TCACAGTAAATGCCCTATATAGG - Intergenic
1201639368 Y:16162249-16162271 TCACGGTAACTGCCCTATACAGG + Intergenic
1201663445 Y:16423078-16423100 TCACGGTAACTGCCCTATACAGG - Intergenic
1202302501 Y:23432192-23432214 TCATGGTAAGTGCCCTATACAGG - Intergenic
1202568310 Y:26238402-26238424 TCATGGTAAGTGCCCTATACAGG + Intergenic