ID: 1080590310

View in Genome Browser
Species Human (GRCh38)
Location 11:33717716-33717738
Sequence GCTTCCTCCTAACCTGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080590308_1080590310 14 Left 1080590308 11:33717679-33717701 CCACATTTGAATATCCATCTAAC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1080590310 11:33717716-33717738 GCTTCCTCCTAACCTGCAACTGG 0: 1
1: 0
2: 0
3: 18
4: 127
1080590309_1080590310 0 Left 1080590309 11:33717693-33717715 CCATCTAACTGTGCAATTGAGAA 0: 1
1: 1
2: 5
3: 22
4: 271
Right 1080590310 11:33717716-33717738 GCTTCCTCCTAACCTGCAACTGG 0: 1
1: 0
2: 0
3: 18
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080590310 Original CRISPR GCTTCCTCCTAACCTGCAAC TGG Intronic
900676033 1:3886894-3886916 GCTTCCTCCTGAGCTGCAGGAGG - Intergenic
901234810 1:7662040-7662062 GCCTCGTCCTGCCCTGCAACTGG + Intronic
902580354 1:17404050-17404072 TGTGCCTCCCAACCTGCAACAGG + Intergenic
904906499 1:33901032-33901054 GCTTCCTCCTCACCTACACGTGG - Intronic
909680600 1:78287303-78287325 GCTTCATCGTAACCTGCATCAGG - Intergenic
911209453 1:95124041-95124063 GCATCCTCCTTACCTACAAGAGG + Intronic
911413182 1:97536889-97536911 GCTGCCTCAAAACCTGCAAAGGG + Intronic
912801567 1:112722876-112722898 ACTTCCTCCTCCCCTGCCACTGG + Intronic
916199226 1:162254321-162254343 GCATCCTCCTAAACTGCTCCTGG - Intronic
919847179 1:201649460-201649482 GCTTTCTCCTAACCAGCTGCTGG + Intronic
920255407 1:204651118-204651140 GCTTCCTCAGAACCAGCAACAGG - Intronic
922743887 1:228032199-228032221 GCTTCCTCCTGGCCTCCAGCTGG - Intronic
1062916212 10:1242702-1242724 GCTTTCTCCTGTCCTCCAACGGG + Intronic
1065505727 10:26428367-26428389 CCTGCCTCCTTACCTGCTACTGG - Intergenic
1066397549 10:35040970-35040992 GGTTCCTCCTAACAGGCCACAGG + Intronic
1071743024 10:88383653-88383675 GCTTCCACCTACCCTTCAATTGG + Intronic
1072475545 10:95756551-95756573 GCTGCCTCTTAAACTGCAAGGGG - Intronic
1078612817 11:12836505-12836527 GCTTCCTCCTAACCCCAAACTGG + Intronic
1080465760 11:32495700-32495722 CCTTCCTCCTAAGCTGCAGGGGG + Intergenic
1080590310 11:33717716-33717738 GCTTCCTCCTAACCTGCAACTGG + Intronic
1084116507 11:67045763-67045785 TCTTCCTCCCATCCTGCAGCAGG - Exonic
1088654154 11:111983299-111983321 GCTCCCAGCTAGCCTGCAACAGG + Intronic
1090948045 11:131448926-131448948 GCTTCCTCCTAAACAGAAGCAGG - Intronic
1092742773 12:11646845-11646867 GCTTCCATTTAACCTTCAACTGG + Intergenic
1094725954 12:33116381-33116403 TCTTCCTCTCAGCCTGCAACCGG - Intergenic
1096220164 12:49824117-49824139 GCTCCCTCCTAGGCTGCAGCAGG + Intronic
1098324164 12:69283575-69283597 GATTCCTCCTACCCGACAACAGG - Intergenic
1098357939 12:69628765-69628787 GCTTCCTCTTCACATGCCACAGG - Intergenic
1100016513 12:90017123-90017145 GCTTTCTCCTAGCCTACACCAGG + Intergenic
1102022945 12:109696443-109696465 CCTTCCTCCTGACCTCCCACTGG - Intergenic
1107264054 13:38530055-38530077 ACTTGCTCCTAAACTGCAACTGG + Intergenic
1109450332 13:62506057-62506079 GCCTCCTCCTGACCTTCACCAGG - Intergenic
1111398100 13:87694900-87694922 CCTTCCTTCTAATCTTCAACAGG - Exonic
1112281896 13:98070009-98070031 GCTCCCACCTGCCCTGCAACAGG - Intergenic
1114381382 14:22208155-22208177 GCTGTCTCCAAACCTGCAGCTGG + Intergenic
1121181964 14:91935741-91935763 GCTTCCTTATAACCAGCATCAGG - Intronic
1125423824 15:39530395-39530417 CCTTCCTCCCAACCTGCCTCTGG + Intergenic
1128336357 15:66788234-66788256 GCCTCCTCCAAACCTCCAAATGG - Intergenic
1128515707 15:68340623-68340645 GCTTCCCCTTGTCCTGCAACTGG - Intronic
1129864318 15:78892197-78892219 GTTTCCTCCTAAACAGAAACAGG - Exonic
1132947225 16:2538240-2538262 GGTGCCTCCTTACCTGCAGCCGG + Intronic
1132980697 16:2737467-2737489 GCTCTCTCCTGACCTGCAACTGG + Intergenic
1135620775 16:23953441-23953463 GCTTTCTCCCCAGCTGCAACAGG - Intronic
1138343858 16:56308089-56308111 TCTTCCTCCTTTCCTGCAGCTGG - Intronic
1138552067 16:57753618-57753640 ACTTCCTCCTAACCCACACCTGG + Intronic
1143163860 17:4887825-4887847 GCCTCCTCCTGACCTGCCCCGGG + Intronic
1144175744 17:12705360-12705382 GCTACCTACTCACCTGCAAGGGG + Intronic
1144339733 17:14301593-14301615 GCTTCCTCCTCACCGGCGGCGGG - Exonic
1145882173 17:28360300-28360322 GCATGCTCCTACCCTGGAACAGG + Intronic
1145907855 17:28526084-28526106 GGTGTCTCCTAACCTGCAAATGG + Intronic
1147758699 17:42784027-42784049 GGTTCCTCCCATCCTGCACCGGG + Exonic
1148352369 17:46950295-46950317 GCCTCCTCCTCACCTACAAGAGG - Intronic
1150419873 17:65023838-65023860 GCTTCTACCTAACCTTCAAGTGG + Intronic
1151745395 17:76009109-76009131 GCTTCCTCCTCTCCAGCAGCAGG + Exonic
1152359695 17:79825952-79825974 GCTGCTCCCTAACCTGCAGCTGG - Intergenic
1160654751 19:259391-259413 GGTTATTCCTAACCTGTAACAGG + Intergenic
1160995452 19:1880161-1880183 GCATCCTCCTGCCCTGCAGCTGG - Intronic
1161109259 19:2460124-2460146 ACTTCCTCCTGACCTAGAACTGG + Intergenic
1161624739 19:5319782-5319804 GGTTCCTCCTCACCTCCATCAGG + Intronic
1162465307 19:10836062-10836084 GCTTCCTCCCCGCCGGCAACAGG + Exonic
1166948125 19:46409498-46409520 GCTTCCTCCTAACCTCCACAGGG + Intergenic
1167146236 19:47681966-47681988 GCTGGCTCCTCTCCTGCAACGGG - Exonic
1167606031 19:50481610-50481632 GCATCCTCCTAGCCTGCCTCGGG - Intronic
925150328 2:1611052-1611074 GCTTCCTCCTCCCCAGTAACAGG - Intergenic
925150448 2:1611524-1611546 GCTTCCTCCTCCCCAGTAACAGG - Intergenic
925150496 2:1611725-1611747 GCTTCCTCCTCCCCAGTAACAGG - Intergenic
925151432 2:1618019-1618041 GCAGCTTCCTAACCTGCAACAGG - Intergenic
926224177 2:10955559-10955581 GCTTCCTCCTGCCCTGCACCTGG + Intergenic
928125593 2:28613442-28613464 ACTAACTCCTCACCTGCAACTGG + Intronic
928144985 2:28765435-28765457 GCTTCCACCTAACCCTCTACTGG - Intronic
933582901 2:84147480-84147502 GCTTCTTCCAAACCTCCCACTGG - Intergenic
934769124 2:96896675-96896697 GCTTCCTCCTCACCTAGGACAGG + Intronic
938630662 2:133163384-133163406 TCTTGCTCCTGAGCTGCAACAGG + Intronic
938770830 2:134499421-134499443 GCTGCCTCCCAACCTGCAGGTGG - Intronic
940406671 2:153311673-153311695 GCTGCCTCATAGCCTGCAGCTGG + Intergenic
940856222 2:158730600-158730622 TCTTGCTACTAACCTTCAACAGG + Intergenic
942696275 2:178650184-178650206 GGTTCCTCCTCTTCTGCAACAGG + Exonic
943299914 2:186185851-186185873 CCTTCCCCCTACCCTGCGACAGG - Intergenic
944923006 2:204434903-204434925 GCTTTCTCCTAATCTCTAACTGG - Intergenic
945967613 2:216205680-216205702 GCTTCCTCCCAACAAGCAGCTGG + Exonic
947285011 2:228504737-228504759 TCTTCATCCTAACCTTCACCTGG - Intergenic
1169547148 20:6661909-6661931 ACTTCCTGCTAACTTCCAACAGG + Intergenic
1170116647 20:12867134-12867156 GCAGCTTCCTAACCTCCAACAGG - Intergenic
1170353782 20:15470452-15470474 ATCTCCTCCTAACCTTCAACAGG + Intronic
1171238011 20:23543698-23543720 GCTTCAAACTAACCTGTAACCGG - Intergenic
1175194605 20:57234196-57234218 GCTTCCTCCCATCCCTCAACTGG - Intronic
1175560156 20:59918531-59918553 GCTTCCACATAACCTTCAATTGG + Intronic
1184590395 22:45478210-45478232 GATTCCTCCATACCTGCAGCTGG + Intergenic
953848664 3:46449005-46449027 ACTTCCTCCTCACCTGCCAGAGG + Exonic
955245776 3:57223612-57223634 GCTTCCCCCTACTCTGCTACTGG + Intronic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
956843935 3:73165298-73165320 GCTCCCTGCCAACATGCAACTGG + Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
961504754 3:127362702-127362724 GCTTCCTCCCTCCCTGCCACAGG + Intergenic
961575317 3:127831361-127831383 CCTGCCTCCTCACCTGAAACAGG + Intergenic
963764865 3:149324153-149324175 GCTACCTCCTAATCTGCATCTGG + Intronic
964570503 3:158104341-158104363 TCTTCCTCCAAACCAGCACCAGG - Intronic
965061588 3:163790839-163790861 GCTTCCTCGTTGCCTGAAACTGG + Intergenic
967488543 3:190062054-190062076 GCTTACTTCTACCCTTCAACAGG + Intronic
970278746 4:14430687-14430709 GGTTCCTCCTCACCAGCAACAGG - Intergenic
972788297 4:42347166-42347188 GCTTCGTGCAAGCCTGCAACTGG - Intergenic
975733704 4:77361584-77361606 GCTTCCTTCCAACATGTAACAGG - Intronic
978195751 4:105970016-105970038 GCTTCCTCTCACTCTGCAACAGG - Intronic
980496050 4:133588258-133588280 ACTTCCTCAAATCCTGCAACAGG + Intergenic
982130361 4:152223952-152223974 GCTTTCTCCTAACCTGCCTTAGG - Intergenic
984131622 4:175881834-175881856 CCCTCCTCCCACCCTGCAACAGG - Intronic
984250807 4:177332324-177332346 GCTTCTACCTCACCTTCAACAGG + Intronic
992203022 5:74402533-74402555 ACTTCCTCTTAACCTGCTCCTGG - Intergenic
994420613 5:99524352-99524374 ACTTTCTCCTCACTTGCAACAGG - Intergenic
996450585 5:123618641-123618663 GCATCCACCTAACCTTCAACAGG - Intergenic
998180979 5:139941671-139941693 ACTTCCACCTAACCTTCAACTGG - Intronic
998814347 5:145997398-145997420 GCTTCCATCTACACTGCAACTGG + Intronic
1001951304 5:175818396-175818418 GCTTCCTCCTAGCCTGGGACAGG - Intronic
1004402310 6:15299990-15300012 GTTTCCTCCCAACCTCCAAAAGG + Intronic
1006083387 6:31580348-31580370 CCTTCCTCCCACCCTCCAACTGG + Intergenic
1006372757 6:33655629-33655651 GCTTCCTCTCTACCTGCAGCGGG + Intronic
1006868851 6:37232017-37232039 GCTTTCTCCTTACCTGAAACTGG + Intronic
1007795482 6:44343319-44343341 GCTTCCTTCTAAACTTCAAATGG - Intronic
1008934816 6:56979171-56979193 GCTTCCACCTAACCTTTAATTGG + Intronic
1011652791 6:89522441-89522463 GCTTCCTCAAAACCTGCTAAAGG + Intronic
1017174223 6:151487707-151487729 GCTTCCATCTAACCTTCAACTGG + Intergenic
1018127230 6:160693171-160693193 GCTTCCTAGAAGCCTGCAACTGG - Intergenic
1018981927 6:168607824-168607846 GCTCCATCCAACCCTGCAACGGG + Intronic
1019774698 7:2905698-2905720 GCTTGCTCCTGACCTGCAGGAGG + Intergenic
1022182143 7:27931334-27931356 GGTTCCTCCACACCAGCAACTGG - Intronic
1027431193 7:78114496-78114518 GCTTGCTCATATCCTGCCACTGG - Intronic
1028105140 7:86868082-86868104 GCTTCCAACTAACTTGCATCAGG + Intergenic
1032800421 7:135313157-135313179 GCTTCCTCCATCCCTGCAACAGG - Intergenic
1034786907 7:153934752-153934774 GCTTCCTCGTTTCCTGCAAGTGG - Intronic
1035015106 7:155758880-155758902 GCTGCATCCCAACCTGCCACTGG + Intronic
1038818671 8:30932225-30932247 GCTTCCAACTAACTTGCATCAGG - Intergenic
1039932170 8:42003162-42003184 GCTATCTCCTATCCTGCCACTGG + Intronic
1041143908 8:54851171-54851193 GCTTCCTGCTAACCTGCACATGG - Intergenic
1041755105 8:61305007-61305029 GGCTCCTCCTAACCTGCCATGGG + Intronic
1046254468 8:111678499-111678521 TATTCCTCCTAAGCTGCAATGGG - Intergenic
1047174218 8:122525129-122525151 CCTTCCTCCTGCCCTGCAATAGG - Intergenic
1050887632 9:10785622-10785644 GCTGCCACCTAACCTCCAAGAGG + Intergenic
1051845710 9:21449239-21449261 GGTGCCTCCAAACCTGCTACTGG - Intergenic
1058927667 9:109683496-109683518 TCTTCCTCATAACCTCCAAAAGG + Intronic
1059798327 9:117724220-117724242 GCTTCCTCCTTGCCTGCTGCAGG + Intergenic
1061713120 9:132501265-132501287 GCTTCTTCCTCACCTGCAAATGG + Intronic
1203565618 Un_KI270744v1:85018-85040 GCTTGCCCCTACCCTGCCACAGG + Intergenic
1185906077 X:3935021-3935043 GCTTCCTCCTAACATCCCAAAGG + Intergenic
1187405084 X:18996680-18996702 GCCTCCTCCTGACCTGCCCCAGG + Intronic
1189274110 X:39772423-39772445 GCTTCCTCCCAACCAACAGCCGG + Intergenic
1192089649 X:68140494-68140516 GCTTCATGCTGACCTGCAAGTGG - Intronic