ID: 1080591837

View in Genome Browser
Species Human (GRCh38)
Location 11:33731202-33731224
Sequence CCTAACCCTGCATTGTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080591833_1080591837 -3 Left 1080591833 11:33731182-33731204 CCGTGTAGGTGGTCAGTGTCCCT 0: 1
1: 0
2: 3
3: 15
4: 129
Right 1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG 0: 1
1: 0
2: 2
3: 19
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080591837 Original CRISPR CCTAACCCTGCATTGTTTTA GGG Intronic
905900647 1:41580230-41580252 CCTCACCCTGCATTGTCCCATGG - Exonic
906003639 1:42449075-42449097 TTTAACTCTGCATTGTTCTAAGG + Intronic
907906885 1:58790620-58790642 CTTAACCCTTCCTTGTTTTTTGG + Intergenic
908521109 1:64943358-64943380 CCTATCCCTGGACTGTTTTCAGG - Intronic
910052895 1:82996988-82997010 CTTAACCCTGTATTGTTCAAGGG + Intergenic
910703403 1:90101326-90101348 GCTCACCCTGTATGGTTTTATGG + Intergenic
911456746 1:98134096-98134118 CCAACCCCTGCATTGTTCAAGGG - Intergenic
912063211 1:105700346-105700368 CCTCAACCTCCCTTGTTTTATGG + Intergenic
914079373 1:144392573-144392595 CCTAACCCTATATTGTTCAAGGG - Intergenic
914099806 1:144573929-144573951 CCTAACCCTATATTGTTCAAGGG + Intergenic
917255563 1:173112268-173112290 CCTAACACTGCTTTGGTTTGAGG + Intergenic
917649999 1:177066965-177066987 ACTAACCCTGCAGTCTTTCAAGG + Intronic
919331270 1:196175249-196175271 CCTAACCCTGAATTGTTCAAGGG + Intergenic
921128291 1:212197216-212197238 CCCCAACCTGCATTGTTGTAGGG + Intergenic
921177274 1:212606489-212606511 CCTTCCCTTGCATTGTTTTGTGG + Intronic
921580709 1:216892899-216892921 GCCAACCTTGCCTTGTTTTAAGG + Intronic
922949460 1:229546443-229546465 CCAACCCCTGCATTGTTCAAGGG + Intronic
923274792 1:232386635-232386657 CCTAACAGTGCACTGTTTTGAGG - Intergenic
1069096399 10:64264825-64264847 CCAACCCCTGCATTGTTGAAGGG - Intergenic
1070079710 10:73173572-73173594 CTAACCCCTGCATTGTTTAAGGG - Intronic
1071219127 10:83443220-83443242 CCAAATCCTGAATTGTTTTCTGG + Intergenic
1072687146 10:97544482-97544504 CCTAACCCTGCGTTGTTCAAGGG - Intronic
1073754325 10:106564937-106564959 CCTAGTTCTGCATAGTTTTAGGG - Intergenic
1074910197 10:117901445-117901467 CCTAACCCTGTGTTGTTCAAGGG - Intergenic
1077486321 11:2839998-2840020 CCCAACCCTGCATTGTTCAAGGG - Intronic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1082053151 11:47789776-47789798 CTAAACCCTGCATTGTTCAAGGG - Intronic
1085491387 11:76921485-76921507 CATAAGCCTGCAGTGTATTAAGG - Intronic
1086186544 11:84024114-84024136 CCCAACCCTACATTGTTTAAGGG + Intronic
1087498843 11:98925091-98925113 TAGAACCCTTCATTGTTTTATGG - Intergenic
1092788155 12:12048525-12048547 CCTAACCCCACATTGTTCAAGGG - Intergenic
1097993795 12:65865319-65865341 CCAACCCCTGCATTGTTGAAGGG + Intronic
1098225403 12:68316901-68316923 CCTAACCCAGCTTTATTTCATGG + Intronic
1098542294 12:71670447-71670469 CTAAACCCTGCATTGTTCAAGGG - Intronic
1098986093 12:77014042-77014064 CCCACCCCTTCATTGTTTAAGGG + Intergenic
1104483191 12:129126685-129126707 CAGAACCCTGCATTAATTTAAGG - Intronic
1106127487 13:26912303-26912325 CTGAGCCCTGCATTGTTTTATGG + Intergenic
1108009808 13:45994362-45994384 CCTACCCCTTCATTGTTCAAGGG + Intronic
1111443195 13:88307802-88307824 CCCAACGCTGCATAGTATTATGG - Intergenic
1111599376 13:90452139-90452161 CCTAACTCTGCTTTGTTCAAAGG + Intergenic
1111633120 13:90868592-90868614 CCAATCCCTGCATTGTTCAATGG - Intergenic
1112264561 13:97911432-97911454 CCTCTCCCTGCCTTGTTTTGAGG - Intergenic
1112416393 13:99206658-99206680 CCTAACTTTGCATTGATTTATGG + Intronic
1113709964 13:112456740-112456762 CAGAACCCTGCATTGATTTGGGG - Intergenic
1117263554 14:54062069-54062091 CCCAACCCTGCATTGTTGAAGGG + Intergenic
1119869416 14:78002553-78002575 TCTACCCCTGCTTTTTTTTAAGG + Intergenic
1121045315 14:90783513-90783535 CTTAACCCAGGATTGTTTTGAGG - Intronic
1121702370 14:95964308-95964330 CCCTATCCTGCATTGTTCTAGGG - Intergenic
1122185608 14:99991931-99991953 CTAACCCCTGCATTGTTTGAGGG + Intronic
1124402629 15:29363045-29363067 CAAAATTCTGCATTGTTTTAAGG + Intronic
1127151874 15:56084189-56084211 CCTGACCCTGCCTTGGTTGATGG - Intergenic
1127434156 15:58939897-58939919 CCTAACCCTGAGTTGTTCAAGGG - Intronic
1130819238 15:87476537-87476559 GCTTACCCTGCAGTGTTTTAGGG + Intergenic
1131656085 15:94460684-94460706 CCCAACCCTGCAGTGCTTTGAGG + Intronic
1131911156 15:97204158-97204180 TCAAACCCTGCATTGTTCAAAGG - Intergenic
1132361018 15:101215352-101215374 CCTACCCCTTCATCTTTTTATGG - Intronic
1132773330 16:1577528-1577550 CCTACCCCTGCATTGTTCAAGGG + Intronic
1133195161 16:4164625-4164647 CCTTACACTGAATTGTTTGAAGG - Intergenic
1135737709 16:24945747-24945769 CCTAATCCAGCAGAGTTTTAAGG - Intronic
1137654176 16:50146106-50146128 CCCAACCCTGAATTGTTCAAGGG + Intergenic
1141691270 16:85598061-85598083 CCTGACCCTGGACTGTTTCAGGG + Intergenic
1144067250 17:11635767-11635789 CCTAACCCCTCAGTGTTTCATGG - Intronic
1144471199 17:15542952-15542974 CCTCTCCCTGTTTTGTTTTAAGG + Intronic
1144925267 17:18801741-18801763 CCTCTCCCTGTTTTGTTTTAAGG - Intronic
1146827032 17:36031897-36031919 CCTACCTCTGGCTTGTTTTATGG + Intergenic
1154243855 18:12677757-12677779 CCTAACCCAGGATTTTTTAAGGG + Intronic
1155225394 18:23725409-23725431 CCTAACCCACCATTCTTTTCTGG + Intronic
1155387739 18:25298918-25298940 GCCAACGCTGCATTGTTTTGGGG - Intronic
1155488587 18:26373921-26373943 CCTAATCATGCTTTGTGTTAAGG - Intronic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1158788489 18:60745002-60745024 CCTAACCTTGCATTTTTTCCGGG - Intergenic
1158810283 18:61025417-61025439 AGTAATCCTGAATTGTTTTATGG - Intergenic
1159139756 18:64379340-64379362 TCTAACCCTGCATTGTTCAAGGG - Intergenic
1162261336 19:9536758-9536780 CCTAACACTGGTCTGTTTTATGG + Intronic
1163902286 19:20113925-20113947 ACTAACTCTGTATTTTTTTAAGG + Intronic
1165615554 19:37196925-37196947 CCCAAGCCTGCATCGTTTGAAGG + Intronic
925919941 2:8631641-8631663 CCCAGCACTGCCTTGTTTTAGGG + Intergenic
927419120 2:22911410-22911432 CATAACCATGCATTGTTTATGGG + Intergenic
928334622 2:30385994-30386016 CCTGACCCTGCAGAGTTCTATGG - Intergenic
929673246 2:43896369-43896391 CCTAATCTTGCATTTTTTAAGGG + Intronic
930113856 2:47701982-47702004 CCAAACCCTGCCTTCTTTTCTGG - Intronic
933661556 2:84931676-84931698 CCTGACCCTGGGTTGATTTAGGG - Intergenic
935164571 2:100559238-100559260 ACTAACACCACATTGTTTTAAGG + Intergenic
936393729 2:112101439-112101461 CCTAACCCTACATTGTTCAAGGG - Intronic
936960883 2:118073415-118073437 CTTAACCCTGCATTGTGCAATGG + Intergenic
937162392 2:119776927-119776949 CTAAACCCTGCATTGTTCAAAGG + Intronic
938059392 2:128240278-128240300 CCTCACCCTGGATTGTTGTGAGG - Intronic
940315797 2:152326384-152326406 CCAAACCCTGAATTGTTCAAGGG + Intergenic
942483172 2:176411363-176411385 CCTAAACCTGCCTGGTTATAAGG + Intergenic
944499808 2:200347657-200347679 CCTAGCCCTACTTTGCTTTAGGG - Intronic
944772791 2:202931471-202931493 CCAATTCCTGCATTGTTTGAGGG + Intronic
946846235 2:223861187-223861209 CCTCACCCTACATTCTTTTTAGG + Intronic
1168733618 20:110217-110239 CCTAACCCTGCATATTTCAAAGG - Intergenic
1172391115 20:34566211-34566233 TCTAACCCTGCATTGTTACATGG + Intronic
1174487410 20:50870228-50870250 CCTGACCCTGCCTGGTTTTTGGG - Intronic
1177515748 21:22148788-22148810 CCTAAACCTGCATTGTATCGTGG + Intergenic
1184450824 22:44581855-44581877 TCTAAACATTCATTGTTTTAAGG + Intergenic
949161384 3:886946-886968 CCTAAGCATGCATTGATTTAAGG - Intergenic
949198576 3:1343323-1343345 CCAACCCCTGCATTGTTCAAAGG + Intronic
949647680 3:6116259-6116281 CCTAATCCTGCATTGTTCAAAGG - Intergenic
951039520 3:17973585-17973607 CCTAAATCTGCAGTGATTTATGG + Intronic
953268671 3:41418134-41418156 CCTAACCCTGTGTTGTTCAAGGG - Intronic
953444560 3:42951767-42951789 CCAAACTGTGAATTGTTTTAGGG + Intronic
959927734 3:111942959-111942981 CCCAACCCTGTATTGTTTTAGGG + Intronic
960850969 3:122053363-122053385 CCTAAACATTTATTGTTTTAAGG + Intergenic
962162718 3:133016172-133016194 CCAACCCCTGCATTGTTCAAGGG + Intergenic
963131769 3:141864855-141864877 CAGAACACTTCATTGTTTTAGGG - Intergenic
971032676 4:22658069-22658091 CCTAACCCTGGGTTGTTCAAGGG + Intergenic
971235772 4:24840916-24840938 CCTAACCCTGCATTTCTTCTAGG + Intronic
971467478 4:26978848-26978870 CCCAACCCTGCATCCTTTCAAGG - Intronic
972011715 4:34190880-34190902 CCTAAACCTCCATTGTATTTTGG + Intergenic
975795216 4:77999847-77999869 CCTAACCTTTCATTGTTCAAGGG - Intergenic
978865113 4:113497784-113497806 CCTAGACTTACATTGTTTTATGG - Intronic
980841699 4:138269123-138269145 CCTAAAACTGCATTATTTTCTGG + Intergenic
981571758 4:146159201-146159223 CCCTAACCTGCATTGTTTGAGGG + Intergenic
982953232 4:161727610-161727632 CCTAACCCTGCATTTTTGCATGG + Intronic
983741927 4:171145686-171145708 CATAACCCTGCATTATTTAAGGG + Intergenic
984350172 4:178579917-178579939 TCTAACCTTTCATTGTTTTGTGG - Intergenic
984520340 4:180794957-180794979 CCCAACTCTGCATGGTTTTTAGG - Intergenic
986551992 5:8967090-8967112 CCTGACCTTGCATTGATTTCAGG + Intergenic
988354243 5:30152136-30152158 CCTAACACTGCATTGTAACAAGG + Intergenic
991350132 5:65712468-65712490 CTTAACCCTTCCCTGTTTTAAGG + Intronic
993014297 5:82518421-82518443 TCTGCCCCTGCATTGTGTTATGG + Intergenic
994242313 5:97438815-97438837 CCAAACTCTGCTTTATTTTAAGG - Intergenic
994419188 5:99511348-99511370 CCTGACCCTGATTTGTTTTCTGG + Intergenic
994440619 5:99798933-99798955 CATAACCCTGCATCTTTCTACGG + Intergenic
994544342 5:101143970-101143992 TATAACCCTACATTGTTTTTAGG + Intergenic
995342733 5:111077667-111077689 CCTAATCCTCAATTCTTTTAGGG - Intronic
996482506 5:123990869-123990891 CCAAACCCTGCTTTTTTTTTAGG - Intergenic
997418809 5:133750119-133750141 CCTAACTCTGACTTGTTTTTTGG - Intergenic
998119657 5:139565443-139565465 CCCCACCCTGCTATGTTTTAAGG + Intronic
1004576016 6:16895784-16895806 CCCAAACCTGCATTGTTCAAGGG + Intergenic
1005069368 6:21850332-21850354 CCTACCCCCACATTGTTTAAGGG + Intergenic
1009633609 6:66234153-66234175 CCTACCCCTCCATTGTTCAAGGG - Intergenic
1010969828 6:82251531-82251553 CCTCACCCTGCTTTCTTTTGGGG - Intergenic
1012404467 6:98879336-98879358 CCTAAACCTACATTGTTTTAGGG + Intronic
1013554489 6:111242047-111242069 CCAACCCCTGCATTGTTCAATGG - Intergenic
1014269830 6:119324466-119324488 CCAATCCCTGCATTGTTCAAGGG + Intronic
1015390067 6:132671827-132671849 CCTCACACTGCATTGTATCAAGG + Intergenic
1015731506 6:136352744-136352766 CCATACCCTTCATAGTTTTATGG - Intronic
1016733522 6:147451499-147451521 CCTACCCCTGAATTGTTCAAGGG - Intergenic
1017570053 6:155734531-155734553 CCTCACCCTGCAATATTTAATGG - Intergenic
1018145316 6:160880926-160880948 CCTAAACCTGCAAAATTTTAAGG - Intergenic
1019029974 6:169001486-169001508 CCTAACCCTGCCTTGCTCAAGGG - Intergenic
1020235646 7:6353364-6353386 CCTAAACTTGCATTCTTCTAAGG - Intergenic
1020522021 7:9203130-9203152 AATAACCTTGCATTGTTTTGAGG + Intergenic
1021734191 7:23627154-23627176 ACTGACCCTGCTTTCTTTTAAGG + Intronic
1022196316 7:28070657-28070679 CCAAGCCCTGCAATGTTTCAAGG + Intronic
1025623708 7:63198612-63198634 CTTACCCCTGCATTGTTCAAAGG - Intergenic
1028017118 7:85730091-85730113 CCTAACACTGCATTCTTCAAGGG + Intergenic
1028113574 7:86972352-86972374 CCTAACCCTCCTTTGTTCTCAGG + Intronic
1028455815 7:91036844-91036866 CCAACCCCTGCATTGTTCAAGGG + Intronic
1030444295 7:109629690-109629712 CCTTACTTTGCATGGTTTTATGG - Intergenic
1031050574 7:116940877-116940899 CCTAACCCCGCATTGTTCAAAGG + Intergenic
1035493257 7:159298542-159298564 CCTCACCCTGCTTTGGCTTATGG - Intergenic
1036469156 8:9035122-9035144 CTTTACCTTGCACTGTTTTATGG - Intronic
1041525849 8:58804684-58804706 CCGACCCCTGCATTGTTCGAGGG + Intergenic
1043394686 8:79825126-79825148 CCTAACACTGGATTTGTTTAAGG + Intergenic
1045396971 8:101770876-101770898 CTTAACCCTGCATTGTAATACGG - Intronic
1048958024 8:139553002-139553024 CCTCACCCTGCATTGATGTCAGG - Intergenic
1051296775 9:15604706-15604728 CCAATCCCTGGATTGTCTTAAGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1059462349 9:114441320-114441342 CTAAGCCCTGCATTGTTTAAGGG + Intronic
1060005481 9:119995897-119995919 CTTACCTCTGCATTGTTTAAGGG - Intergenic
1060297582 9:122353660-122353682 GCCACCCCTGCATTGTTTAAGGG + Intergenic
1190814757 X:53920119-53920141 CTTAACCCTGCATTGTTCAAAGG - Intergenic
1192459743 X:71306882-71306904 CCCAACCTTGCATTGTTCAAGGG - Intergenic
1192875936 X:75229874-75229896 CCTAACCCTGGATTCTTCTCAGG - Intergenic
1195278586 X:103308582-103308604 CCTCTCCCTGCTTTGTTTCATGG - Intergenic
1195737155 X:108023932-108023954 CCTGACCCTGGGTTGATTTAGGG + Intergenic
1196017767 X:110957639-110957661 TCTTACCCTGGGTTGTTTTAGGG + Intronic
1198892167 X:141410036-141410058 CATAACCCAACATTATTTTAGGG + Intergenic
1200390891 X:155945682-155945704 CCTTACCCTAGATGGTTTTAGGG - Intergenic