ID: 1080593138

View in Genome Browser
Species Human (GRCh38)
Location 11:33741296-33741318
Sequence ACAACCTTGAATTTAATTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080593138_1080593139 2 Left 1080593138 11:33741296-33741318 CCTGAAATTAAATTCAAGGTTGT 0: 1
1: 0
2: 1
3: 19
4: 343
Right 1080593139 11:33741321-33741343 TGATGAAAAATTTAAAGTCAAGG 0: 1
1: 1
2: 5
3: 53
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080593138 Original CRISPR ACAACCTTGAATTTAATTTC AGG (reversed) Exonic
900357685 1:2272640-2272662 ACATGGTTGTATTTAATTTCAGG - Intronic
902417267 1:16247689-16247711 ACAAGCTTAAATTTCATTTTAGG - Exonic
903589816 1:24446268-24446290 CCAACTTTTAATTTAATTTCAGG + Intronic
904661275 1:32087191-32087213 AGAATCTTAAAATTAATTTCAGG + Intronic
905086591 1:35384791-35384813 ATAACCTAGTAATTAATTTCAGG - Intronic
906253436 1:44329349-44329371 TCAACCATGAATTTCCTTTCAGG + Intronic
907573716 1:55506984-55507006 ACAACATTCATGTTAATTTCTGG + Intergenic
907729389 1:57051178-57051200 ACAACCTTATATTTCATTTGTGG + Intronic
909268411 1:73591965-73591987 AAAACCTTGAATTCAAATCCAGG + Intergenic
909375000 1:74930083-74930105 AAAACTTTTATTTTAATTTCTGG - Intergenic
909575246 1:77167993-77168015 TCAACCTTTATTTTAAATTCAGG - Intronic
910179295 1:84463806-84463828 CCAAGCTTGAAGTTAATTGCTGG + Intergenic
910216041 1:84845711-84845733 AAAACCTTGAATATATATTCTGG - Intronic
910278261 1:85470927-85470949 ACAAGCCTGAATTTGATTCCTGG + Intronic
910594505 1:88965001-88965023 AAAACCTTGAATTTAAATATGGG + Intronic
910987067 1:93015593-93015615 ACAAATTTGAGTTTAATTTTTGG + Intergenic
911310540 1:96287599-96287621 CCAACCAAGAATTTAATATCTGG - Intergenic
911760090 1:101603438-101603460 CTAACCTTGAAGTTAGTTTCAGG - Intergenic
911922588 1:103784554-103784576 ACAAATTTTAAATTAATTTCAGG - Intergenic
911989355 1:104672763-104672785 AAAATTTTGAATTTAATTCCAGG + Intergenic
912905500 1:113701803-113701825 GCAACCTGGAATTCAATTCCTGG + Intronic
914334606 1:146702956-146702978 TCAACTTTGATTTTAAATTCAGG + Intergenic
915505513 1:156353505-156353527 ACAACCATGAATGACATTTCAGG + Intronic
917091577 1:171358839-171358861 GCAGCTTAGAATTTAATTTCAGG + Intergenic
917337591 1:173941470-173941492 ACAAAATTGAATATGATTTCTGG - Intronic
918890678 1:190263165-190263187 AAATCCTTGAAATTGATTTCTGG + Intronic
919129479 1:193435403-193435425 ACCACCTTTAATTTGATCTCTGG - Intergenic
919149044 1:193671661-193671683 ACATCCTTAAATTCAATTGCAGG - Intergenic
919280038 1:195478007-195478029 TCAATCTAGAATATAATTTCAGG - Intergenic
919297018 1:195715327-195715349 ACAAGCTTGAACTTATTTACAGG - Intergenic
919481407 1:198094438-198094460 ACAATGTTGAACTTAAATTCTGG - Intergenic
921109425 1:212018946-212018968 AATACCTTAAATTTAAATTCTGG + Intronic
922638210 1:227198700-227198722 AAAACCTTTAATTTTATTTTAGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063789421 10:9425171-9425193 ATAACAGTGAAATTAATTTCAGG + Intergenic
1063945172 10:11169017-11169039 AGAACCCTAAATTTAATTTCTGG + Intronic
1064731910 10:18339745-18339767 AGAACATTGATTTGAATTTCAGG + Intronic
1064962254 10:20978163-20978185 ATAAACTTGAATCTCATTTCGGG - Intronic
1066626418 10:37410903-37410925 ACAACTTTGATTTTAGGTTCAGG - Intergenic
1067422778 10:46171305-46171327 TCAACCTTTATTTTAAGTTCTGG - Intergenic
1068347579 10:55801930-55801952 TCAACCTTTATTTTAAGTTCTGG + Intergenic
1068441608 10:57062561-57062583 ACAACTTTAATTTTAAGTTCAGG - Intergenic
1069406200 10:68102012-68102034 AGAACCCAGAATTTAAATTCTGG - Intergenic
1070355443 10:75635490-75635512 AGAACCTTGAATTCTATTTTGGG - Intronic
1071530270 10:86385540-86385562 TCAACCTGGAATTTAATGTATGG - Intergenic
1072670899 10:97428318-97428340 ACAGCCTTGAATCTGATTTCTGG + Intronic
1074731290 10:116378942-116378964 AAAACCTTGAATTCAATTGTTGG + Intronic
1079208833 11:18442290-18442312 ATAACCTTGAGTTTGAGTTCAGG - Intronic
1079276468 11:19041843-19041865 CCAACCTAGAATTTCATATCTGG + Intergenic
1079277355 11:19053892-19053914 ACAACCTGGAATGAAATTGCAGG - Intergenic
1079928318 11:26524339-26524361 ACAACTTTAAAATTATTTTCTGG + Intronic
1080153585 11:29080418-29080440 AAAACTTTGATTTTAAGTTCAGG - Intergenic
1080593138 11:33741296-33741318 ACAACCTTGAATTTAATTTCAGG - Exonic
1080901547 11:36497628-36497650 ATAACACTAAATTTAATTTCTGG + Intronic
1081656385 11:44860399-44860421 AACCCCTTGAATTTGATTTCTGG + Exonic
1082575614 11:54799475-54799497 TCAACCCAGAATTTCATTTCTGG + Intergenic
1085904366 11:80742222-80742244 ACAATCTTGCATTTTTTTTCTGG - Intergenic
1086021628 11:82237937-82237959 CCAACCTGGAATTTAATATCCGG - Intergenic
1086431887 11:86744025-86744047 ACAAACCTGGATTTAAATTCCGG + Intergenic
1087105813 11:94405768-94405790 GCAACTTAGAATTTAATTTGGGG - Intergenic
1087205266 11:95387470-95387492 ACAACCTTGTCATTACTTTCAGG - Intergenic
1087370471 11:97277605-97277627 ACAACTTTTGTTTTAATTTCAGG - Intergenic
1087463993 11:98481722-98481744 AAAACCTAGAATTTATGTTCTGG + Intergenic
1088008507 11:104970799-104970821 CCAACCCAGAATTTAATGTCTGG + Intergenic
1088806345 11:113356697-113356719 CCAACCCAGAATTTCATTTCTGG - Intronic
1088980272 11:114856737-114856759 ACAACCTTGAATTGAGTTCAAGG + Intergenic
1092059087 12:5533702-5533724 CAAACCATGAATCTAATTTCAGG - Intronic
1093349675 12:18082472-18082494 AAAACTTTGAATTTAGGTTCAGG - Intronic
1095686432 12:45040948-45040970 AAAACCTTCAAATAAATTTCAGG + Intronic
1097462172 12:59875100-59875122 ACTACCCTGAAATTAAATTCTGG - Intergenic
1098958969 12:76718594-76718616 ACAAACTGGAGTTGAATTTCTGG - Intergenic
1099503854 12:83447778-83447800 ACAACCTTAGATTTTACTTCTGG + Intergenic
1100165204 12:91909181-91909203 TCAACCTTTATTTTAAGTTCAGG - Intergenic
1100588478 12:96001252-96001274 ACATCCTTTAATTTAATCTTGGG - Intronic
1103059775 12:117849045-117849067 ACAAACTTGGGTTTAAGTTCTGG - Intronic
1103507234 12:121449780-121449802 ACAAAAATGCATTTAATTTCAGG + Intronic
1107247740 13:38317968-38317990 CCAACTTTTATTTTAATTTCAGG + Intergenic
1107390717 13:39960324-39960346 CCAACCTTAAAGCTAATTTCAGG + Intergenic
1108051929 13:46453714-46453736 ACAACCTTCCATTTAAATTTAGG + Intergenic
1108341970 13:49506063-49506085 ACAACCAGGAATTTAAATACAGG - Intronic
1108541354 13:51450457-51450479 AGAACTCTGAATTAAATTTCAGG - Intronic
1109037446 13:57284342-57284364 ACTAGCTTGTATATAATTTCAGG + Intergenic
1109539361 13:63752497-63752519 ACAACCTTCCATTTAAATTTAGG - Intergenic
1109544483 13:63827337-63827359 ACAACCTTCCATTTAAATTTAGG + Intergenic
1109663265 13:65493686-65493708 ACAAAATTGAAATTAATTTTTGG - Intergenic
1109890609 13:68607742-68607764 ACAACCTAGAACTTAAAGTCAGG + Intergenic
1111435678 13:88203814-88203836 ACAGCATTGAATTTAATGTTGGG + Intergenic
1111478724 13:88792479-88792501 ATAAACTTTAATTTAATATCAGG - Intergenic
1111582671 13:90245007-90245029 AAAACATTGACTTAAATTTCAGG - Intergenic
1111709913 13:91798183-91798205 TCAACTTTTAATTTAAGTTCTGG + Intronic
1112913646 13:104520987-104521009 CCAACCTAGAATTTTATATCTGG - Intergenic
1113328155 13:109303437-109303459 ACATAATTGAATTTAATTTGGGG + Intergenic
1113491390 13:110694751-110694773 ACTCCCTTGACTTTAATTTTTGG - Intronic
1115385616 14:32792897-32792919 TCAACCCAGAATTTAATATCTGG + Intronic
1116586652 14:46714169-46714191 ACAACCTGGAATTTAATGATAGG + Intergenic
1116671479 14:47847656-47847678 CCAACCTAGAATTTCATATCCGG + Intergenic
1117325769 14:54667749-54667771 ACACCCTTTACTTTATTTTCTGG + Intronic
1117857330 14:60049526-60049548 CCAACCTAGAATTTCATATCTGG - Intronic
1117888880 14:60396414-60396436 TCAGCCTTGCATTTAGTTTCAGG - Intergenic
1119321834 14:73736748-73736770 ACAACCTAGAATTCAATTCTAGG + Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1122616680 14:103022738-103022760 TCACCCTAGAATTTAATTTATGG - Intronic
1124584063 15:30989564-30989586 ACAAACTAGTATTTGATTTCAGG + Intronic
1124985276 15:34603710-34603732 TCAACTTTTAATTTAAGTTCTGG + Intergenic
1125373479 15:39002687-39002709 CCAACCTAGAATTTCATATCTGG + Intergenic
1126888702 15:53180675-53180697 AAAACTTTTATTTTAATTTCAGG - Intergenic
1127362486 15:58256894-58256916 CCAACCTAGAATTTTATATCCGG + Intronic
1128264937 15:66257418-66257440 ACAAGCTTGAGTTCAAATTCAGG - Intergenic
1128437186 15:67664661-67664683 ATAAGCTTGGATTTAATTTGGGG + Intronic
1129143152 15:73621029-73621051 ACATCTATGAATTTTATTTCAGG + Intronic
1130619172 15:85443531-85443553 AGAACCATGAAATAAATTTCTGG + Intronic
1130715732 15:86331668-86331690 CCAACCTAGAATTTTATATCTGG + Intronic
1131916877 15:97276499-97276521 AAAACCTTTATTTTAAATTCAGG + Intergenic
1137527494 16:49249223-49249245 AGCACCTTGAATTTATTTTATGG + Intergenic
1139999015 16:71008276-71008298 TCAACTTTGATTTTAAATTCAGG - Intronic
1140078878 16:71725639-71725661 TCCACCTTGAAATTATTTTCAGG + Intergenic
1140572349 16:76122600-76122622 AAAACCTGGGATTTAATTTCAGG + Intergenic
1140655751 16:77137657-77137679 TCAACTTTGATTTTAAGTTCCGG + Intergenic
1140758997 16:78094481-78094503 TCAACTTTTACTTTAATTTCAGG + Intergenic
1141306396 16:82868032-82868054 ACAAGCTTGTATTTACTTTCAGG + Intronic
1141812464 16:86384740-86384762 ACAACTTTTATTTTAAGTTCAGG + Intergenic
1143826228 17:9609969-9609991 AAAACCTGGAATCTGATTTCTGG + Intronic
1149109814 17:53015036-53015058 AAAACACTGAATTTATTTTCAGG + Intergenic
1149230841 17:54532259-54532281 ACAACATTTATTTTAAGTTCAGG + Intergenic
1151108284 17:71644656-71644678 CCAACCTAGAATTTGATATCTGG + Intergenic
1151808947 17:76424572-76424594 AAAACATTAAAATTAATTTCTGG + Intronic
1153550081 18:6253323-6253345 AAAACCTGGAATTCAAATTCAGG + Intronic
1154496017 18:14961919-14961941 ACAACTTTGCATTTTATATCTGG + Intergenic
1155027896 18:21958861-21958883 TCAAACTTGAATTCAATTCCTGG + Intergenic
1156055075 18:32992858-32992880 ACATCCTTGAGTTTAATTAAAGG - Intronic
1156723609 18:40100739-40100761 TAAACCTTGACATTAATTTCAGG + Intergenic
926756891 2:16243631-16243653 CCACCCTTGAAGTTAATTTTTGG + Intergenic
926960904 2:18357525-18357547 CTAACCTTAAATTTATTTTCAGG + Intronic
930546000 2:52767649-52767671 TCAACCTAGAATTTCATATCCGG + Intergenic
930860153 2:56063820-56063842 TCAACCCAGAATTTAATATCTGG - Intergenic
931254392 2:60557115-60557137 ACAACGTTAAAATTATTTTCTGG + Intergenic
931854798 2:66291880-66291902 TGAACCTTGAAGTGAATTTCCGG - Intergenic
932449812 2:71802263-71802285 GCACCCTTGAATTTACCTTCAGG - Intergenic
932565514 2:72905230-72905252 ACAACTTAGAATTGTATTTCTGG - Intergenic
934592720 2:95570695-95570717 AAAAATTTTAATTTAATTTCTGG - Intergenic
935099202 2:99976719-99976741 AAAACCTTTAATTTCATTTCAGG + Intronic
936608168 2:113977908-113977930 ACAACCTGAAACCTAATTTCTGG - Intergenic
936778974 2:116008760-116008782 CCAACCTTGATTTTAACATCTGG - Intergenic
938136282 2:128760203-128760225 TCAACCTTTATTTTAAGTTCAGG + Intergenic
939834537 2:147112579-147112601 ACAACCTGTAATTTCAGTTCTGG - Intergenic
939849517 2:147287642-147287664 ATATATTTGAATTTAATTTCAGG - Intergenic
939858999 2:147395242-147395264 ACAACCTTGGATTTAAATTTTGG + Intergenic
939945596 2:148406201-148406223 ACAACAATGAACATAATTTCTGG + Intronic
940128301 2:150352607-150352629 ACAACCTTTGATTTAATTTGAGG + Intergenic
940262071 2:151791412-151791434 TCAACTTTTATTTTAATTTCAGG + Intronic
940810676 2:158239194-158239216 AGAATCTTGAATTTAACTCCAGG - Intronic
941298963 2:163776979-163777001 AAACCCTTGGATTTAATTTAGGG + Intergenic
941712394 2:168727997-168728019 ACAAATTTTAATGTAATTTCAGG + Intronic
943879023 2:193114414-193114436 AAAACCTTGAAGATAATCTCAGG + Intergenic
945395708 2:209313222-209313244 AAAACCTTAAATTTAATCTTAGG - Intergenic
945563067 2:211362322-211362344 TCAACCTTTATTTTAATTTCAGG + Intergenic
945889941 2:215419428-215419450 ATAACTACGAATTTAATTTCAGG + Intronic
946599208 2:221340864-221340886 ACAGCCTTAAAATTATTTTCAGG - Intergenic
947929777 2:233954408-233954430 GTAACTTTGCATTTAATTTCAGG + Intronic
948317296 2:237038014-237038036 ACTACCTTGATTTTAATTAATGG + Intergenic
948555666 2:238808870-238808892 TCAACCTTGAATTCCATATCTGG - Intergenic
1171107305 20:22446604-22446626 ACAACCTTATATTTATTTCCAGG + Intergenic
1173116732 20:40250859-40250881 ATAAGCATGAATTTATTTTCTGG - Intergenic
1173327299 20:42045870-42045892 ACTACCTTGAATTATGTTTCTGG - Intergenic
1173764388 20:45594299-45594321 CCAACCTAGAATTTAATATTTGG - Intergenic
1175454370 20:59099842-59099864 TTAACCTTTATTTTAATTTCAGG + Intergenic
1176919802 21:14674360-14674382 ATAACCTAGAATTTGAATTCAGG + Intergenic
1177130764 21:17252144-17252166 GAAACCTTGAATTCAAGTTCTGG - Intergenic
1177516388 21:22156822-22156844 AAAACTTTGATTATAATTTCTGG + Intergenic
1177556473 21:22695715-22695737 CCAACCTAGAATTTCATATCTGG - Intergenic
1177558675 21:22722156-22722178 ACCACTTTGAATTAAAATTCTGG + Intergenic
1177591833 21:23180724-23180746 ACAACATTAAATTTAGTTACTGG + Intergenic
1177641165 21:23846022-23846044 GCAACCTTGAATTTCTCTTCAGG + Intergenic
1177887208 21:26761529-26761551 ACAACCATGAAGTTATATTCTGG + Intergenic
1178202205 21:30420053-30420075 AAAACCATGAATGAAATTTCTGG - Intronic
1178263720 21:31123524-31123546 AGCACCTTAAATTTAATTTAGGG - Intronic
1179355181 21:40652301-40652323 CCAACCTTAATTTTAACTTCAGG - Intronic
1179468613 21:41595617-41595639 ACAAACCGGAATTTAAATTCAGG + Intergenic
1184683097 22:46083098-46083120 TTAAACTTGAATTTAATTTTTGG + Intronic
951559377 3:23950303-23950325 ACAACCTTGACTTTAAACTTTGG + Intronic
953053119 3:39363733-39363755 CCAACCCAGAATTTAATATCTGG + Intergenic
954976762 3:54703218-54703240 CCAACTTTTAATTTAAGTTCAGG - Intronic
956285320 3:67602680-67602702 AAAACCATTAATTTAAATTCAGG + Intronic
956695401 3:71914771-71914793 CCAACCTTGAATATATTTTAAGG + Intergenic
956914006 3:73851637-73851659 AGAAGCTTGGATTTAATTTGAGG + Intergenic
957507019 3:81135034-81135056 ATAAGCTTGTATTTAATTCCTGG - Intergenic
957907953 3:86581842-86581864 TCAACCTTCATTTTAAGTTCGGG - Intergenic
959178013 3:102941653-102941675 AAAACTGTGAATTTTATTTCAGG + Intergenic
959466593 3:106694990-106695012 AGAACCTTGAATTTAATGGAAGG + Intergenic
959805584 3:110548969-110548991 ACAACCTTGAATTTACTCAAAGG + Intergenic
962053270 3:131841860-131841882 ACCACCTTCAATTTCATATCAGG - Intronic
962449345 3:135499067-135499089 ATCATCCTGAATTTAATTTCAGG - Intergenic
963416075 3:144997523-144997545 CCAACCTAGAATTTCATATCTGG - Intergenic
963913803 3:150839577-150839599 CCAACCTAGAATTTCATATCTGG - Intergenic
964061950 3:152536131-152536153 GCAACCTAGAATTTCATTTCTGG - Intergenic
964917814 3:161857448-161857470 ATGCCCTTTAATTTAATTTCAGG - Intergenic
965227851 3:166012760-166012782 TCAACCTTTATTTTAAGTTCAGG - Intergenic
965918237 3:173877915-173877937 TCAACCTGGAATTTTACTTCTGG + Intronic
965966414 3:174495900-174495922 AAAACTTTGTATATAATTTCAGG + Intronic
966080776 3:175997337-175997359 CCAACCTAGAATTTCATATCTGG + Intergenic
966126788 3:176587068-176587090 GCAACTTTGTATTTATTTTCAGG + Intergenic
966564665 3:181363069-181363091 TCTACCTTAAATTTAATTTGTGG - Intergenic
966675093 3:182576944-182576966 ACAAAAGTGAATTTTATTTCAGG + Intergenic
969082612 4:4630967-4630989 AAAACCTTTATTTTAAGTTCAGG - Intergenic
969986763 4:11219405-11219427 ACAACCTTGAAAAGAAGTTCAGG - Intergenic
971079482 4:23193289-23193311 CCAACCTGGAATTTTATATCTGG - Intergenic
971255800 4:25012354-25012376 ACCACATTGAAATGAATTTCCGG - Exonic
971604255 4:28637241-28637263 ACAAACTTGAGTTTATTCTCTGG + Intergenic
971614893 4:28776003-28776025 ACAAGCCTGAATTGAAATTCTGG + Intergenic
972383188 4:38538344-38538366 ACCATCTTAAATTTAATTTGTGG + Intergenic
972623539 4:40773331-40773353 ACAAACTTGAAGTTAAATCCAGG - Intronic
972815919 4:42645426-42645448 ACAACCTTGAATTTACTTGCTGG - Intronic
972866438 4:43238843-43238865 ACAGCCTAGAATTAAAATTCAGG + Intergenic
973568453 4:52212535-52212557 CCAACCTTTATTTTAAGTTCAGG - Intergenic
973897900 4:55434387-55434409 ACATTCTTGAAATTACTTTCAGG + Exonic
974130330 4:57746993-57747015 CCAACCCAGAATTTAATATCTGG - Intergenic
974240187 4:59236740-59236762 CCAACCAAGAATTTAATATCAGG - Intergenic
974320784 4:60346623-60346645 AAAACCTTGAAAGTAACTTCAGG + Intergenic
974361575 4:60887550-60887572 ACAACCTATAATATAAATTCAGG + Intergenic
974663160 4:64921210-64921232 CCAACCCTGAATTTTATATCTGG + Intergenic
975305265 4:72842059-72842081 AAAACCTTGAATTTATTTGAAGG + Intergenic
976029055 4:80729279-80729301 ACACCTGTGAATTTATTTTCAGG - Intronic
976055329 4:81058869-81058891 ACCACCTTGAGTTTGAATTCTGG + Intergenic
976436779 4:85027325-85027347 AGAATCTTAAATTTAATTTGTGG + Intergenic
976755649 4:88494956-88494978 AAAACTTTCATTTTAATTTCAGG + Intronic
977730179 4:100341792-100341814 CCAACGTTGAATTTAGTTTTTGG + Intergenic
977878068 4:102172267-102172289 AAAAACTTGAACTTAAATTCTGG + Intergenic
978305250 4:107321107-107321129 ACAACCTGGATTTTTATTTTTGG - Intergenic
978871068 4:113578633-113578655 ACAAACTTGAGTAAAATTTCTGG - Intronic
979041460 4:115802623-115802645 AAAACCTTAAATTGAAATTCAGG + Intergenic
979132925 4:117071147-117071169 ACAAACTTGAATGTATCTTCAGG - Intergenic
980021927 4:127721242-127721264 CCAACCTAGAATTTCATATCTGG - Exonic
982677390 4:158391535-158391557 ACAATATTAAATTTCATTTCAGG + Intronic
982910253 4:161132584-161132606 ACAACATTTATTTTAAGTTCAGG + Intergenic
982989110 4:162247855-162247877 ACAACCTTGAAATTATTCTTTGG - Intergenic
984129921 4:175861832-175861854 ACAACCTTAAATTTATATTAGGG - Intronic
984370249 4:178855065-178855087 ACTACCTTCATTTTAATTTTTGG - Intergenic
984466273 4:180102453-180102475 ACAACATTGAACATATTTTCTGG - Intergenic
987141389 5:14950513-14950535 CTAATCTTGAATTTCATTTCTGG + Intergenic
987618749 5:20311043-20311065 ACAATATTGAATTCAATGTCTGG - Intronic
987776248 5:22371141-22371163 AAAAGCTTAATTTTAATTTCTGG + Intronic
988276264 5:29084532-29084554 GCAACCTTGATTAAAATTTCTGG - Intergenic
989029477 5:37103638-37103660 ACAACCCAGAATTTCATATCCGG - Intergenic
989829623 5:45899298-45899320 TCAACATTGATTTTAATTTTGGG + Intergenic
989959873 5:50400054-50400076 ACAATGTTGAATTTATTTTATGG + Intronic
990618919 5:57538933-57538955 ACAGCCTTGAAATTAAGCTCTGG - Intergenic
992371427 5:76148137-76148159 AGAACCTTGAACTTGGTTTCTGG - Intronic
993225338 5:85162856-85162878 TCAACCAAGAATTTAATATCTGG - Intergenic
993260521 5:85652509-85652531 CATACCTTGAATCTAATTTCTGG - Intergenic
993837483 5:92833732-92833754 CCAACCTAGAATTTCATATCTGG - Intergenic
994514531 5:100753910-100753932 GTAACCTTGAAATTTATTTCAGG - Intergenic
995652920 5:114391464-114391486 AAAAGCTTGGATTTAATTTCTGG - Intronic
996279430 5:121710425-121710447 ACAACATAAAATTTAGTTTCAGG - Intergenic
998253779 5:140569702-140569724 ACAGACTTGAATTTGAATTCTGG + Intronic
999524351 5:152386653-152386675 AGAATTTTGAATATAATTTCAGG + Intergenic
1000426945 5:161102214-161102236 ACAAACTTTAATTTAATCTCTGG - Intergenic
1000428887 5:161126649-161126671 TCAACCTTCATTTTAGTTTCAGG - Intergenic
1000994043 5:167941208-167941230 AAAACCTTGATTTTATTTTAAGG + Intronic
1000994883 5:167948568-167948590 AGAACCTGGAATTTATTTTTAGG - Intronic
1001695073 5:173663909-173663931 ACAACCTGAACATTAATTTCAGG - Intergenic
1004470151 6:15921815-15921837 AAAACATTGAATTTATTTCCTGG - Intergenic
1004622730 6:17345239-17345261 ACAACCTTGAATGTGTTTTGGGG - Intergenic
1004742117 6:18472147-18472169 ACAAGCTTGAAATGTATTTCAGG - Intergenic
1008083976 6:47224308-47224330 ACAACTTTTATTTTAAGTTCAGG - Intergenic
1009574295 6:65432317-65432339 ACCTCCTTGAACTTAAATTCTGG + Intronic
1009887670 6:69643166-69643188 ACTACCTTGAATTTAACTGATGG - Intergenic
1010108718 6:72199003-72199025 ACTTCCTTGCATTGAATTTCTGG - Intronic
1010430027 6:75768261-75768283 AAAATCTTGTATTTAAATTCAGG - Intronic
1010440370 6:75887338-75887360 CCAACTTTTATTTTAATTTCAGG - Intronic
1011100339 6:83713219-83713241 AAAAAATTGAATTTATTTTCTGG + Intergenic
1011290082 6:85767924-85767946 ATAACTTTAAATATAATTTCAGG + Intergenic
1011446167 6:87443629-87443651 ACAACCTTTATTTTAGATTCAGG + Intronic
1011835378 6:91424197-91424219 ACTACATTGCATTTAGTTTCAGG + Intergenic
1012869657 6:104658264-104658286 CCAACCTAGAATTTCATATCTGG + Intergenic
1013202342 6:107911448-107911470 ACATCCATGAATTTATTTTGAGG + Intronic
1014883671 6:126753317-126753339 TCAACCTTTATTTTAAGTTCTGG - Intergenic
1015182734 6:130378375-130378397 AGAACATTGAATTTGAGTTCAGG - Intronic
1015775289 6:136808010-136808032 ACTACCTTTATTTTAATTACAGG + Intergenic
1016091979 6:139990873-139990895 ACAGCCCTGATTTTATTTTCAGG - Intergenic
1018485005 6:164232223-164232245 ATAATCTTGAATTTACTCTCAGG + Intergenic
1019867254 7:3723575-3723597 ACAACATATACTTTAATTTCAGG - Intronic
1020223150 7:6257009-6257031 ACTACTTTGAACTAAATTTCAGG + Intronic
1022377206 7:29825327-29825349 TCAACTTTTATTTTAATTTCTGG - Intronic
1023626501 7:42120071-42120093 GCAACTTTAAATTTAATTTGCGG + Intronic
1024376391 7:48643376-48643398 ACTACCTTGAACTGAATTCCTGG - Exonic
1027604188 7:80279924-80279946 GCAACCTTGAACATAGTTTCTGG - Intergenic
1030891714 7:115006829-115006851 ACAAAGGTGAATATAATTTCTGG - Intronic
1031420552 7:121546471-121546493 ACAGCATTGAGTTTGATTTCTGG - Intergenic
1034917653 7:155054190-155054212 CCAACTTTGATTTTAAGTTCTGG + Intergenic
1036283661 8:7423840-7423862 AAAACTATGAAATTAATTTCTGG + Intergenic
1036337808 8:7887689-7887711 AAAACTATGAAATTAATTTCTGG - Intergenic
1037421892 8:18711008-18711030 CCGACCTAGAATTTAATATCTGG + Intronic
1039318637 8:36402448-36402470 TCAACTTAGAAGTTAATTTCAGG + Intergenic
1039333694 8:36566938-36566960 ACAACTTTTATTTTAAGTTCAGG + Intergenic
1042473307 8:69215875-69215897 CCAACCTAGAATTTCATATCTGG + Intergenic
1042521361 8:69714954-69714976 ACAACCATGCTTTTCATTTCAGG + Intronic
1042821944 8:72938926-72938948 ACAACCTTTTAAATAATTTCAGG - Intergenic
1043226289 8:77735395-77735417 ACAACTTTGAATTGAGTTTGAGG - Intergenic
1043269588 8:78314934-78314956 AAAACTTTTATTTTAATTTCAGG + Intergenic
1043273575 8:78365074-78365096 AAAGACTTGATTTTAATTTCTGG - Intergenic
1044174936 8:89108211-89108233 ACAACATTGAATATACTGTCAGG - Intergenic
1044763667 8:95548904-95548926 ACACTCTTGAATTGAATATCTGG + Intergenic
1045176434 8:99730227-99730249 ACAACAATGAATTTCATATCTGG - Intronic
1045299802 8:100901178-100901200 ACATCATTTAAATTAATTTCAGG + Intergenic
1045840925 8:106579707-106579729 AACAGCTTGAATTTAATTCCTGG - Intronic
1046160699 8:110360130-110360152 ACAAACGGGAATTTTATTTCTGG - Intergenic
1046181161 8:110649954-110649976 ACAATCTTGAATAAAATCTCAGG - Intergenic
1046966057 8:120167078-120167100 ATATCCTGGAATTTAATCTCTGG + Intronic
1048766745 8:137853111-137853133 ACAACACTGAATTTAATATAAGG + Intergenic
1048804605 8:138228425-138228447 ACAACCTTGAATATGGTGTCAGG - Intronic
1048942190 8:139410399-139410421 ACATACTTGTAATTAATTTCTGG + Intergenic
1049911606 9:274027-274049 ACAGCCTTAAATTTTCTTTCAGG + Intronic
1050143475 9:2540803-2540825 AGAACACTGAGTTTAATTTCAGG + Intergenic
1050686990 9:8182856-8182878 ACAAGTTGGATTTTAATTTCAGG - Intergenic
1052027166 9:23586478-23586500 AGAACTTTGAATTTATTTACTGG + Intergenic
1052138055 9:24940288-24940310 AAAACCCTGAATTTTTTTTCTGG - Intergenic
1052374178 9:27699014-27699036 ACTACCTTGAAAGTAATTTCAGG - Intergenic
1053108576 9:35436821-35436843 ACAAACTTGTATTTAAGTTCAGG + Intergenic
1053728794 9:41031207-41031229 ACAACCTTGCGCTTAAGTTCAGG + Intergenic
1054699714 9:68400873-68400895 ACAACCTTGCGCTTAAGTTCAGG - Intronic
1055158411 9:73094272-73094294 ACAAGTTTAATTTTAATTTCTGG + Intergenic
1055377850 9:75669619-75669641 ACAAGTTTGAATTTGCTTTCTGG - Intergenic
1055842904 9:80527366-80527388 CCAACCCAGAATTTAATATCTGG + Intergenic
1058459917 9:105173158-105173180 AAAACTTAGAATTTAGTTTCAGG + Intergenic
1059509809 9:114834697-114834719 TCAACCTAGAATTTTATATCTGG - Intergenic
1059609836 9:115880479-115880501 ACAATCTTGGATTTGATTTTAGG + Intergenic
1059651195 9:116317711-116317733 AAAATCATGAATTTTATTTCAGG - Intronic
1059764441 9:117370665-117370687 AGGAACCTGAATTTAATTTCTGG - Intronic
1060870596 9:127036868-127036890 ACAAATTTGCATTTAATTTTAGG + Intronic
1061271482 9:129546070-129546092 TCAACCTTGAATTTTTCTTCTGG + Intergenic
1061867725 9:133502903-133502925 CCAACCTAGAATTCAATATCCGG + Intergenic
1186593777 X:10959068-10959090 CCAACTTTGATTTTAAGTTCAGG - Intergenic
1186669353 X:11754491-11754513 ACAAACTTTAAATGAATTTCTGG - Intergenic
1186740806 X:12516470-12516492 CCAACCCGGAATTTCATTTCTGG - Intronic
1187044931 X:15638297-15638319 AAATCTTTGAATTTAATTTGAGG + Intronic
1187593861 X:20748899-20748921 AAAACCTGGAATTTAAATCCAGG - Intergenic
1187640209 X:21279470-21279492 TCAACCTTTATTTTAAGTTCAGG + Intergenic
1188326269 X:28805929-28805951 ACATCTTTGTATTTCATTTCTGG + Intronic
1188632588 X:32384666-32384688 ATAACCTTCAATCTACTTTCAGG + Intronic
1188696085 X:33192661-33192683 AAAACCCTCAATTTAAATTCTGG + Intronic
1189173899 X:38935090-38935112 TCAATCTTTTATTTAATTTCAGG + Intergenic
1189543001 X:42012129-42012151 TCAACCTTTATTTTAGTTTCAGG - Intergenic
1189726199 X:43970044-43970066 ACAACCTTGCTTTTATTGTCCGG + Intronic
1189947452 X:46193843-46193865 AAAACCTTGACTTTCATTTCTGG + Intergenic
1190001885 X:46696924-46696946 ACAACCTGGGATTGAATCTCAGG - Intronic
1191601409 X:63013297-63013319 ACAGCCTTGATTTTGAGTTCTGG + Intergenic
1193364985 X:80621683-80621705 TCAACCCAGAATTTCATTTCTGG - Intergenic
1193664178 X:84295983-84296005 TCAACTTTTATTTTAATTTCAGG + Intergenic
1193799491 X:85917433-85917455 AAAACTTTGATTTTAAGTTCAGG - Intronic
1193894007 X:87087940-87087962 ACAACTTTTATTTTAAGTTCAGG - Intergenic
1194132922 X:90104755-90104777 TCAACCCAGAATTTAATATCAGG - Intergenic
1194252026 X:91587641-91587663 CCAACCTGGAATTTTATATCTGG - Intergenic
1194405904 X:93495340-93495362 CCAACCTAGAATTTTATTTCTGG + Intergenic
1194414600 X:93595265-93595287 ACAACCTTTATTTTATTTTCTGG - Intergenic
1197180692 X:123533263-123533285 TCAACCTAGAATTTCATATCTGG - Intergenic
1197733065 X:129828175-129828197 ACAATTTTGTATGTAATTTCAGG - Intronic
1197992963 X:132338081-132338103 ACAACTTTTTAGTTAATTTCTGG + Intergenic
1198648471 X:138835923-138835945 CCAACCTAGAATTTCATATCTGG - Intronic
1200478710 Y:3674833-3674855 TCAACCCAGAATTTAATATCAGG - Intergenic
1200570957 Y:4828879-4828901 CCAACCTGGAATTTTATATCTGG - Intergenic
1201453197 Y:14138797-14138819 ACAACGTTGACTATTATTTCTGG + Intergenic
1202259257 Y:22952815-22952837 AAAATCTGGAATTTTATTTCAGG - Intergenic
1202412243 Y:24586559-24586581 AAAATCTGGAATTTTATTTCAGG - Intergenic
1202458537 Y:25083509-25083531 AAAATCTGGAATTTTATTTCAGG + Intergenic