ID: 1080593222

View in Genome Browser
Species Human (GRCh38)
Location 11:33742463-33742485
Sequence CCAGCTCAGTATGGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080593216_1080593222 13 Left 1080593216 11:33742427-33742449 CCGAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG 0: 1
1: 0
2: 0
3: 5
4: 139
1080593209_1080593222 26 Left 1080593209 11:33742414-33742436 CCACCTCATCCTCCCGAGTAGCT 0: 55
1: 6735
2: 38157
3: 49108
4: 40403
Right 1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG 0: 1
1: 0
2: 0
3: 5
4: 139
1080593211_1080593222 23 Left 1080593211 11:33742417-33742439 CCTCATCCTCCCGAGTAGCTGGG 0: 452
1: 102074
2: 284200
3: 226885
4: 126866
Right 1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG 0: 1
1: 0
2: 0
3: 5
4: 139
1080593208_1080593222 27 Left 1080593208 11:33742413-33742435 CCCACCTCATCCTCCCGAGTAGC 0: 53
1: 7079
2: 130875
3: 286391
4: 197429
Right 1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG 0: 1
1: 0
2: 0
3: 5
4: 139
1080593215_1080593222 14 Left 1080593215 11:33742426-33742448 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG 0: 1
1: 0
2: 0
3: 5
4: 139
1080593213_1080593222 17 Left 1080593213 11:33742423-33742445 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG 0: 1
1: 0
2: 0
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080593222 Original CRISPR CCAGCTCAGTATGGTTTTAA TGG Intronic
903908117 1:26700821-26700843 CCATCTCAGTGTGGTTTTCCTGG - Intronic
904129301 1:28263660-28263682 CCAGCTCAGTCTGGCTTCCAAGG - Intronic
904700225 1:32353570-32353592 CCAGCTCAGCATGGGGTTCAGGG + Intronic
905064700 1:35170496-35170518 ACAACTCATTATGGTTTTCAGGG - Intergenic
907075634 1:51575570-51575592 CCAGCTCAGGGTGGTCTTACTGG - Intergenic
907571102 1:55484854-55484876 CCAGATCAGTATTTTTTTAAAGG + Intergenic
909074092 1:71032177-71032199 TCATCTCACTATGGTGTTAATGG + Intronic
910684208 1:89899804-89899826 CAAGCTCAGAAAGGTTTCAAAGG - Intronic
911777354 1:101831274-101831296 CTAGCTCAGTAAGTTCTTAATGG + Intronic
912073656 1:105845317-105845339 CCTGCTTAGTCTGGTCTTAAAGG - Intergenic
914523161 1:148436278-148436300 TCAGCTCTGTCTGGTTTAAACGG + Intergenic
917262202 1:173182383-173182405 GCAGCTCTGTATGGATGTAATGG - Intergenic
918053418 1:180995557-180995579 CCAGCTGAGTATATTTTTAAAGG - Intronic
1062858302 10:790534-790556 CCAGCCCTGAATGGTTTTTAAGG - Intergenic
1064168358 10:13005980-13006002 CCACCTCAGTATGGTTTCTGGGG - Intronic
1067548724 10:47217825-47217847 CCTGCTCAGTAATGTATTAAAGG + Intergenic
1069454620 10:68544306-68544328 CCACCTCTGTAGGGTTATAATGG + Intergenic
1071149625 10:82619291-82619313 CCAGCTCACACTGGTATTAAAGG - Intronic
1071521778 10:86335974-86335996 CCAGCTGAGTATGGTTTCCATGG + Intronic
1074104501 10:110378269-110378291 CCACCTGAGCCTGGTTTTAAAGG - Intergenic
1075023996 10:118970403-118970425 CAAGCCAAGAATGGTTTTAAAGG + Intergenic
1077985121 11:7343523-7343545 CCACCTCAGCCTGGATTTAATGG + Intronic
1078721160 11:13884391-13884413 CCTGCTCAGCATGGTTTCTAAGG + Intergenic
1079975636 11:27087878-27087900 CCATCACAGTGTGGTTATAATGG - Intronic
1080593222 11:33742463-33742485 CCAGCTCAGTATGGTTTTAATGG + Intronic
1085585354 11:77698486-77698508 CTAGCTCAGGATGGTTTGGAAGG + Exonic
1086131994 11:83410509-83410531 CTAGCTCAGGAGGGTTTTGAGGG + Intergenic
1086750370 11:90486374-90486396 CCAGCTCAAGATGGCTTTATAGG + Intergenic
1088673226 11:112164594-112164616 CAAGCTCAATATGGTGTCAAAGG + Intronic
1090295684 11:125585889-125585911 ACATCTCAGTTTGGTTTAAAAGG + Intergenic
1093143470 12:15537177-15537199 CCTGCTCAGTATTTATTTAATGG - Intronic
1097118439 12:56716347-56716369 TCAGCTAAGAATGGTTCTAAAGG - Intronic
1097404131 12:59168000-59168022 CTAGCTCAGTATATTTTGAAAGG + Intergenic
1098785139 12:74743704-74743726 CCAGCTCAGATTGGTTTTTGTGG + Intergenic
1111736430 13:92145838-92145860 GCAGCTCTGTGTGGTTTTGAGGG - Intronic
1113545787 13:111148477-111148499 CAGGCACAGGATGGTTTTAAGGG + Intronic
1116182757 14:41556078-41556100 CTATCTCAGTATGTGTTTAAAGG + Intergenic
1119904709 14:78291041-78291063 CTGGCTCAGCATGGTTTAAAGGG - Intronic
1119940976 14:78641197-78641219 TCAACTTAGTATGGTTTTCAAGG + Intronic
1121246224 14:92462734-92462756 CCACCTCCCTAGGGTTTTAATGG - Intronic
1127403846 15:58620163-58620185 CCAGTTCAATATGTTTTAAACGG - Intronic
1132322601 15:100937004-100937026 CCAGGCCTGTATGGTTTTATAGG - Intronic
1134241224 16:12508567-12508589 CCAGCTCTGTCTGCTTTTTAAGG - Intronic
1137959109 16:52863625-52863647 ACAGCATAGGATGGTTTTAAGGG + Intergenic
1141522061 16:84587130-84587152 CCAGGCCAGTTGGGTTTTAATGG - Intronic
1144184368 17:12782943-12782965 CCAGGTCCATATGGTTTTATGGG - Intergenic
1148597902 17:48871693-48871715 CCAGCTCAGGGAGGATTTAAAGG - Intergenic
1152618299 17:81347882-81347904 CCAGATCAATATGGCCTTAATGG + Intergenic
1152856880 17:82669787-82669809 AGAGCTTAGTAGGGTTTTAAAGG - Intronic
1155695350 18:28678404-28678426 CAAGCTCACTTTTGTTTTAATGG + Intergenic
1155992644 18:32295758-32295780 ACAGCACAATATTGTTTTAATGG + Intronic
1156090633 18:33464545-33464567 CCACCTGAGTATGGATTTTAGGG + Intergenic
1158363664 18:56706405-56706427 CCAGGTCTGTTTGGTTCTAAAGG - Intronic
1158581755 18:58690306-58690328 CCAGATCAGTATGGTGTTGGTGG + Intronic
1160364003 18:78308854-78308876 CAAGCTCTCTATGGTTTTACTGG - Intergenic
1160925170 19:1540878-1540900 CCGGCTCATTTTGTTTTTAAAGG - Intergenic
1164464791 19:28478394-28478416 GCAGCTCAGTATGGTATTTTTGG - Intergenic
1164521419 19:28982924-28982946 CCTCCTCAGTATGGCTTAAAAGG + Intergenic
1167659273 19:50786359-50786381 ACACCTCAGTATGGTGTTCAGGG - Intergenic
1167886619 19:52505181-52505203 CCAGCTCATTCTGGTTTTTGAGG + Intronic
1167892042 19:52548033-52548055 CCAGCTCATTCTGGTTTTTGAGG + Intronic
1167912247 19:52713593-52713615 CCAGCTCATTCTGGTTTTTGAGG - Intronic
931148231 2:59543447-59543469 TCAGCTAAGTATGGCTTTAGGGG + Intergenic
931224351 2:60316695-60316717 TCACCTCAGTCTGGTTTGAAAGG + Intergenic
932650398 2:73549663-73549685 CCAGCTCATGATGGTTTTGGAGG - Intronic
934975299 2:98798041-98798063 CCAACTCTATATGGTTTCAAAGG - Intronic
939818802 2:146930593-146930615 CCAGCTCTGTATCATTTAAAGGG - Intergenic
943099022 2:183465226-183465248 CCAGCTCACAATGATTTTCAAGG - Intergenic
947991211 2:234489077-234489099 ACCTCTCAGTATTGTTTTAAAGG - Intergenic
1177504441 21:22001719-22001741 CCACCTCAGCCTGGTTTTTATGG + Intergenic
1177623462 21:23627303-23627325 CCAGGTAAGTATGGTTTCACAGG - Intergenic
1178708172 21:34890625-34890647 CGAGTTCAGTTTTGTTTTAATGG + Intronic
1179916485 21:44481270-44481292 ACAGCTCAGCATGGTTGGAAAGG + Intergenic
1181010616 22:20038367-20038389 CCAGCTCTGTATGCGTTTCAGGG + Intronic
1184823586 22:46931755-46931777 GCTCCTCAGTATGGCTTTAAAGG - Intronic
950705909 3:14781459-14781481 CCAGGTCCATATGGTTTTACAGG + Intergenic
950827255 3:15837116-15837138 TTAGCTCCGTATGGTTTTTATGG - Intronic
952564927 3:34643585-34643607 CCAGGTCAAGATGGTTTTATTGG + Intergenic
953359173 3:42280069-42280091 CCAGCTCAAGCTGGTGTTAAAGG + Intergenic
957299150 3:78368342-78368364 CCAGCTAATTTTTGTTTTAATGG - Intergenic
959270143 3:104196813-104196835 ACAGCTCAATTTGGTTGTAATGG + Intergenic
960837577 3:121923042-121923064 GCAGCTCATTATGGATGTAAAGG + Exonic
960848825 3:122030546-122030568 CCAACTATGGATGGTTTTAATGG + Intergenic
963258502 3:143170010-143170032 ACAGCTCAGGAAGGTTTTACTGG + Intergenic
966294864 3:178407800-178407822 TCAGCTCAGGATGAATTTAATGG - Intergenic
966834924 3:184041956-184041978 CCATCTCAGTATGGGGTTATAGG - Intergenic
968107989 3:196015954-196015976 CCAGCTCAATTTGACTTTAATGG - Intergenic
968393164 4:209781-209803 CCAGCAGAGTATGTTTTGAAGGG - Intergenic
968402362 4:308996-309018 CCAGCAGAGTATGCTTTGAAGGG + Intergenic
969257771 4:6014295-6014317 CCGGCCTAGTATTGTTTTAAGGG + Intergenic
970139255 4:12962676-12962698 CCAGATTAATATGGTTTGAATGG + Intergenic
974521974 4:62993764-62993786 CAAGCTCAGTATGTATTCAAAGG + Intergenic
975256470 4:72241936-72241958 TCAGGTCAGTGTGTTTTTAAAGG - Intergenic
975463885 4:74687647-74687669 CCATCCCACTATGGTATTAATGG - Intergenic
976949186 4:90808670-90808692 ACATCTCATTGTGGTTTTAATGG - Intronic
982416398 4:155137603-155137625 CCAGGCCCATATGGTTTTAATGG - Intergenic
987018433 5:13845018-13845040 CCAGCTTTGTGTGGTTATAAAGG - Intronic
992607643 5:78475633-78475655 GCAGCTCAGAATGCTTTCAAGGG + Exonic
995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG + Intergenic
996015256 5:118526502-118526524 CCACATCAAAATGGTTTTAACGG + Intergenic
996093156 5:119370837-119370859 CCAGCTCTCTAAAGTTTTAATGG - Intronic
996494002 5:124132344-124132366 CCAGCCCATTCTGGTTTTTAGGG + Intergenic
998779564 5:145641363-145641385 CCATCTCTTTATGGTATTAATGG - Intronic
1000646752 5:163768931-163768953 CCAGCTCAGTCTAATTCTAAAGG + Intergenic
1001804473 5:174571456-174571478 CCAACTCAAAATGGTTTAAAAGG - Intergenic
1002713042 5:181206358-181206380 CAAGCTCAGTAAGGTTTTCTTGG + Intergenic
1003912669 6:10756681-10756703 CCACCTCTGTAGGGTTATAATGG - Exonic
1003968623 6:11277680-11277702 CCATCTCAGTTTGGTGCTAAAGG + Intronic
1004992182 6:21150493-21150515 CCAACTAGGTTTGGTTTTAAGGG - Intronic
1006292624 6:33151675-33151697 CCATCTCAAGATGGTTTTAATGG - Intergenic
1007875456 6:45095319-45095341 CCACCTCAGTAATGTTTTATGGG - Intronic
1007943304 6:45802312-45802334 CCAGCACAGTGAGGTGTTAATGG + Intergenic
1015348685 6:132191057-132191079 CTTCCTCAGTATGGTTTTCATGG + Intergenic
1015564404 6:134552836-134552858 CCAGCTTATACTGGTTTTAAGGG - Intergenic
1017340775 6:153319462-153319484 CCACGTCAGTAAGGTTTTTAGGG + Intergenic
1017605467 6:156128151-156128173 CCAGCTAGGGATGGTTTTAGAGG - Intergenic
1021248491 7:18294342-18294364 GCAGCTCAGTATCATTTTACAGG - Intronic
1021928727 7:25558400-25558422 CCAGCTCATTATAGTTTGAATGG + Intergenic
1022060229 7:26785930-26785952 CCATCTCAGTAGGGATTTCAGGG + Intronic
1025934599 7:66025087-66025109 TCAGCTGAGTTTGGATTTAAAGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1032137625 7:129295263-129295285 CCAGAGCAATCTGGTTTTAAAGG + Intronic
1032655411 7:133923444-133923466 CCAGCCCAGTAGGTTTGTAAGGG + Intronic
1033350808 7:140560247-140560269 CCAGCATAATATGGTTTTACTGG - Intronic
1041094090 8:54332078-54332100 TCAGCTAATTATAGTTTTAAAGG + Intergenic
1041360997 8:57054164-57054186 CCAGCTCCTTATGGTATCAATGG - Intergenic
1041507021 8:58610497-58610519 CCAGCTCATTTTGGTTGTTAGGG - Intronic
1043423036 8:80119710-80119732 CCAGTACTGTGTGGTTTTAAAGG - Intronic
1044226669 8:89726993-89727015 CCAGCTTAGTGTTGTTTTGAGGG - Intergenic
1046402874 8:113729952-113729974 CCAGTTCAGTTAGTTTTTAAAGG - Intergenic
1046721134 8:117620305-117620327 CCACCTTAGAATGGTTTTACTGG + Intergenic
1049526302 8:143128377-143128399 CCAGCTCAGAAGGGGTTGAATGG + Intergenic
1050842107 9:10163625-10163647 CCAACTCAGTATATTTTAAATGG + Intronic
1058675332 9:107395334-107395356 CCTGCACAGTATTGTTTTACAGG - Intergenic
1059541180 9:115132111-115132133 ACAGCTCTGCATGATTTTAAGGG - Intergenic
1062220620 9:135413289-135413311 GCAGCTCAGTGAGGTTGTAAGGG - Intergenic
1189019489 X:37319788-37319810 CTAGCTAAGTCTGGTTTAAATGG - Intergenic
1192169267 X:68844292-68844314 CCTGCTCAGTTTGGCTTTATTGG - Intergenic
1194343660 X:92734102-92734124 CCAGCCCAGAATTTTTTTAATGG + Intergenic
1195696362 X:107670535-107670557 CCACCTCAGCATGTTTTTCAGGG - Intergenic
1198342958 X:135732646-135732668 CCATCTCTGTCTGCTTTTAAAGG - Intergenic
1198345031 X:135750649-135750671 CCATCTCTGTCTGCTTTTAAAGG + Intergenic
1199354090 X:146839791-146839813 CCATCAGAGTCTGGTTTTAAAGG + Intergenic
1199938275 X:152599128-152599150 CCAGCTCAGAATTCTTCTAATGG + Intergenic
1201456296 Y:14170575-14170597 CCAGATCATCATGTTTTTAAAGG - Intergenic