ID: 1080594244

View in Genome Browser
Species Human (GRCh38)
Location 11:33755429-33755451
Sequence ATGAATCAAAGGATGTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080594242_1080594244 18 Left 1080594242 11:33755388-33755410 CCACTGAACAAAGTTTTAAAAGT 0: 1
1: 0
2: 6
3: 60
4: 582
Right 1080594244 11:33755429-33755451 ATGAATCAAAGGATGTTCAAAGG 0: 1
1: 0
2: 2
3: 14
4: 237
1080594241_1080594244 19 Left 1080594241 11:33755387-33755409 CCCACTGAACAAAGTTTTAAAAG 0: 1
1: 0
2: 5
3: 44
4: 553
Right 1080594244 11:33755429-33755451 ATGAATCAAAGGATGTTCAAAGG 0: 1
1: 0
2: 2
3: 14
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080594244 Original CRISPR ATGAATCAAAGGATGTTCAA AGG Intronic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
902148975 1:14426897-14426919 AAGAATCCAAGGATGTGAAAGGG - Intergenic
904393358 1:30199965-30199987 GTGAATTAAAGGATGTTAGAGGG + Intergenic
908965604 1:69758388-69758410 ATTAATAAAAGGATATTCTAGGG - Intronic
909227192 1:73040949-73040971 TTGAACAAAAGGATGTTAAAAGG + Intergenic
909379411 1:74981049-74981071 ATGAATTAGTGGATGTTTAAAGG - Intergenic
910814917 1:91281486-91281508 CTTAATGAAAGGAAGTTCAAAGG - Intronic
911157860 1:94654411-94654433 AGGAATAAAAGGCTGTTAAAAGG + Intergenic
912528645 1:110304087-110304109 ATCCACCAATGGATGTTCAATGG - Intergenic
912748496 1:112266055-112266077 ATGATTCAAAGGGAGTTCTAAGG + Intergenic
913348995 1:117837268-117837290 ATTAATCAAAGAATGGACAAGGG + Intergenic
913696736 1:121333650-121333672 ATAAATCAAAGGATTATTAAGGG + Intronic
914140824 1:144946410-144946432 ATAAATCAAAGGATTATTAAGGG - Intronic
917184195 1:172334414-172334436 GTGCATCATAGGATGTTCAGCGG - Intronic
918781524 1:188705697-188705719 GTGGAGCACAGGATGTTCAAGGG - Intergenic
918965781 1:191345707-191345729 ATGATTCAAAGGATTTTAAGAGG - Intergenic
920484067 1:206352004-206352026 ATAAATCAAAGGATTATTAAGGG + Intronic
921257365 1:213354733-213354755 ATGAATCAATGGATTATCATAGG - Intergenic
921428274 1:215031010-215031032 ATGAAGCAAAGGAAATACAATGG - Intronic
922087724 1:222367121-222367143 ATGAATCCAAGAATATACAAGGG - Intergenic
922326972 1:224536954-224536976 ATGAATCAACGCATGAGCAAAGG + Intronic
922375762 1:224963305-224963327 AAGAATCAAAGCATGTTAAAAGG - Intronic
923322623 1:232849831-232849853 ATGATGCCAAGGAAGTTCAATGG - Intergenic
923762325 1:236858168-236858190 ATGAAGAAAAGGAGGTTTAATGG + Intronic
1065801000 10:29352258-29352280 ATGAATCAAGGGATGATTGAGGG + Intergenic
1066015751 10:31241943-31241965 ATGAATGAATGGATAATCAATGG - Intergenic
1066230820 10:33431270-33431292 ATGAATAAAAGAATGTACAAGGG + Intergenic
1067744082 10:48921345-48921367 AAAGGTCAAAGGATGTTCAATGG + Intronic
1068063359 10:52097822-52097844 ATGATTCATAGCATCTTCAAAGG - Intronic
1072840817 10:98771932-98771954 ATTCATCAGAGGATGTTCCAGGG + Intronic
1073016230 10:100401737-100401759 ATCAATTATAGAATGTTCAAGGG - Intergenic
1079484520 11:20921356-20921378 ATGAATTAAAGCAAGCTCAAAGG - Intronic
1079625461 11:22611818-22611840 ATAAAGAAAAGGATGTTTAATGG + Intergenic
1079849495 11:25513174-25513196 CTGAATCAGAGGAAGTTCACAGG + Intergenic
1080594244 11:33755429-33755451 ATGAATCAAAGGATGTTCAAAGG + Intronic
1080968073 11:37237243-37237265 ATGAATGAAAGGATATGCAATGG - Intergenic
1080974458 11:37320634-37320656 ATGAGTCAATGAATGTTCACTGG - Intergenic
1081246944 11:40778814-40778836 AAGAATAAAAGGATATCCAATGG + Intronic
1081268123 11:41052138-41052160 ATGAATCATAGGGTGTGCAGTGG - Intronic
1081447103 11:43141135-43141157 ATGAGTCGAAGTATGTTCATAGG - Intergenic
1083692344 11:64417598-64417620 ATGAATTAAAGAATGGGCAAAGG + Intergenic
1085342830 11:75744579-75744601 ATGAATCTAAGGGTGGTGAAGGG + Intergenic
1085992853 11:81871469-81871491 AAGAAGAAAAGGATGATCAAAGG + Intergenic
1088013638 11:105034036-105034058 AAGAATCAAAGGAGAGTCAAGGG + Intronic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1091056214 11:132421318-132421340 AAGAAGCAAAGGAGATTCAAAGG + Intronic
1092151307 12:6250824-6250846 ATGAATCCCACGATGTCCAATGG - Intergenic
1092704162 12:11266145-11266167 AAGAATCACAGGAGGTTGAAGGG - Intronic
1092933798 12:13341342-13341364 ATGAAGGAATGGATGTCCAAGGG - Intergenic
1094119175 12:26951058-26951080 ATTAATCAAAGCATCTTCAGAGG - Intronic
1095787284 12:46123457-46123479 ATGAATTAAAGAAAGTTGAAGGG - Intergenic
1097289577 12:57903224-57903246 ATGCCTGAAAGAATGTTCAATGG + Intergenic
1099055649 12:77836617-77836639 TTGAATTAAAGTTTGTTCAAAGG + Intronic
1099389230 12:82058414-82058436 ATGACTCAAGGGATATTTAATGG + Intergenic
1099826287 12:87781034-87781056 ATGAAGAAAAGGAGGTTTAATGG + Intergenic
1100657009 12:96657961-96657983 ATCATCCAAAGGATGCTCAAAGG - Exonic
1101362552 12:104041651-104041673 ATGAATCAAAGAAATGTCAAGGG - Intronic
1102356102 12:112237339-112237361 ATCAATCAAAGTATGTTCTTTGG - Intronic
1103584292 12:121939845-121939867 ATTAATCAAAGCCTCTTCAAAGG - Intronic
1104615461 12:130264564-130264586 ATAAATAAAACCATGTTCAAAGG - Intergenic
1106603358 13:31206121-31206143 ATGAAGTAAAGGACGTTAAATGG + Intronic
1109700687 13:66020791-66020813 TTGAATCAAAGGATGCTCATAGG - Intergenic
1110300892 13:73925754-73925776 ATGAATCACAGGATGTTCTTAGG - Intronic
1112049092 13:95627877-95627899 ATGAATCAAATGTCATTCAATGG + Intronic
1112817731 13:103292599-103292621 TTCAAGGAAAGGATGTTCAAAGG + Intergenic
1113004886 13:105689182-105689204 ATTAATGGAAGGTTGTTCAATGG + Intergenic
1113595004 13:111525012-111525034 ATGAATGAATGGATGATCAGAGG + Intergenic
1113901073 13:113798443-113798465 ATGAATCGAAGGATGGATAATGG + Intronic
1114776244 14:25485267-25485289 ATGAAACAAAGGCTTTTCCAAGG - Intergenic
1115355857 14:32446052-32446074 ATGCATCAAAGAATATTTAAAGG + Intronic
1115440682 14:33431425-33431447 ATAAAACAAAGAATGTTTAATGG - Intronic
1115460924 14:33659853-33659875 AAAAATCAAAGGATGGTCAATGG + Intronic
1118890029 14:69901323-69901345 ATGAGTCAAAGGCTGAACAAAGG - Intronic
1118929446 14:70226940-70226962 ATGAATTGAAGAATGTTCAATGG + Intergenic
1122372811 14:101238057-101238079 ATGAATCTGCTGATGTTCAAAGG + Intergenic
1126022527 15:44416702-44416724 ATGAATGAATGAATGTTCTAAGG + Intergenic
1126760898 15:51969332-51969354 ATACATGAAAAGATGTTCAACGG + Intronic
1128728002 15:70001928-70001950 ATTTTTCAAAGGATGTTAAAAGG - Intergenic
1129533169 15:76286407-76286429 CAGCATCAAAGGATGTTCCACGG + Exonic
1129947743 15:79555852-79555874 ATAAATAAAAGAATGTTCTACGG + Intergenic
1130765766 15:86869380-86869402 ATTAATCCAAGGATGTTGAGCGG - Intronic
1131111867 15:89769472-89769494 ATGAATGAGCGGATGTTCACTGG - Intronic
1131962545 15:97804795-97804817 ATGAAGCCAAGTATGTTCTATGG - Intergenic
1138910943 16:61398002-61398024 ATAATTCAAAGGCTGTCCAATGG + Intergenic
1144327682 17:14197398-14197420 ATAACTCTAAGGATGTTCCATGG + Intronic
1146266096 17:31453913-31453935 CTGAGTCAAAAGATATTCAATGG - Intronic
1147977473 17:44256009-44256031 AATAATCAATGGATGATCAATGG - Intronic
1148823047 17:50371776-50371798 ATGAATGAATAGATGTTTAAAGG - Intronic
1152313304 17:79564217-79564239 ATGAATGAAAGGAAGTCAAATGG - Intergenic
1153108229 18:1552312-1552334 ATTGATCCAAGGATGTTCAGAGG + Intergenic
1153687337 18:7559665-7559687 TTGAATCATAGTATGTTCAAAGG - Intergenic
1156117314 18:33801772-33801794 ATAAAGCAAAGGAGGTTTAAAGG + Intergenic
1157395281 18:47336039-47336061 ATGAACCAATGGATGGTCCATGG - Intergenic
1158083549 18:53623401-53623423 CTGAAACAAAAGTTGTTCAAAGG - Intergenic
1158438693 18:57454093-57454115 ATGAATTCAAAAATGTTCAAAGG - Intronic
1160654541 19:257579-257601 ATGAATAAAAGGGTTTACAAGGG + Intergenic
1161933779 19:7358321-7358343 ATGGATGAATGGATGTTGAATGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
925427750 2:3764609-3764631 ATGAAGAAAAAGAGGTTCAATGG - Intronic
925513493 2:4653556-4653578 ATTTATCAAAGGCTGTTAAAAGG + Intergenic
926884234 2:17582681-17582703 AAGAATAAAAGGATGTTTTAGGG + Intronic
928790156 2:34940465-34940487 ATGAATTAAGGGACTTTCAAGGG - Intergenic
930388954 2:50736183-50736205 AGGAAACACAGCATGTTCAAAGG - Intronic
930424749 2:51198395-51198417 ATGAATGAAAGAATAGTCAAAGG - Intergenic
931161718 2:59700032-59700054 ATGAAGCAAATAATGTACAATGG - Intergenic
931639916 2:64372852-64372874 AAGAATGAATGGAAGTTCAAAGG - Intergenic
931893009 2:66695807-66695829 ATGAATTAAGAGAGGTTCAAGGG + Intergenic
931932590 2:67156847-67156869 CTCAATGAAAGAATGTTCAAAGG + Intergenic
932451330 2:71812569-71812591 ATGAATGAATGAATGTGCAAAGG - Intergenic
933032362 2:77346064-77346086 ATGAATAAAAGGAGGTACTATGG + Intronic
933375236 2:81471111-81471133 ATAAATGAAAAAATGTTCAATGG + Intergenic
934865376 2:97805121-97805143 TTGCATCAAAGCCTGTTCAAGGG - Exonic
935353823 2:102179440-102179462 ATAAGTCAAAGGAAGTTCACGGG - Exonic
935512940 2:103998585-103998607 ATTAAACAAAAGATGTTCCAGGG + Intergenic
936536480 2:113315538-113315560 ATCAATTAAGGGATGTTGAAGGG + Intergenic
936558122 2:113513624-113513646 ATGAGTCGAAGTATGTTCATAGG + Intergenic
937346103 2:121126430-121126452 ATGAATGAAAGGATGACAAAGGG + Intergenic
940954288 2:159711616-159711638 ATGAATCAAAAGTTTTTTAATGG - Intergenic
941233018 2:162934670-162934692 ATCAATTAAAAGATGTTCACTGG - Intergenic
941474455 2:165932732-165932754 ATGATTTAAGGGATTTTCAAGGG + Intronic
941988950 2:171536092-171536114 ATGACTCAAAGGAGTTACAAGGG - Intronic
942871598 2:180740821-180740843 ATGAATCACAAGATGTATAATGG - Intergenic
944535228 2:200702882-200702904 AGAGTTCAAAGGATGTTCAAAGG - Intergenic
944648928 2:201809204-201809226 ATGTATCCAAGTATGTTCCAGGG - Intronic
947273009 2:228359424-228359446 ATGACTTAAAGGGTTTTCAAGGG + Intergenic
947339941 2:229127632-229127654 ATGAATCAGAGGTTGTACAGTGG + Intronic
1169491487 20:6074922-6074944 AGGAAGCAAATGATGTTGAAAGG + Exonic
1170508430 20:17052988-17053010 ATGAAGAAAAAGATGTTTAATGG + Intergenic
1171003319 20:21437014-21437036 ATGTATCAAAGGATTTAAAAAGG - Intergenic
1171926549 20:31193603-31193625 CTGAATCAAAAGGAGTTCAATGG + Intergenic
1173674907 20:44825215-44825237 ATGAAGAAAAGGAGGTTTAATGG + Intergenic
1174187376 20:48716318-48716340 TTTACTCAAAGGATGTCCAAAGG + Intronic
1174468387 20:50735380-50735402 ATGACTCAAAGACTGTTCCAGGG - Intronic
1179078395 21:38145732-38145754 AAGAATCAAAGGCAGTACAATGG - Intronic
1184639029 22:45859203-45859225 GAGAATCAAAGGAGATTCAAAGG - Intergenic
1184996746 22:48212702-48212724 ATGAATGAATGAATATTCAATGG - Intergenic
949180728 3:1127878-1127900 ATGAAACACAGATTGTTCAAGGG + Intronic
949670398 3:6393198-6393220 ATGACTCAAAGGATATTCAATGG + Intergenic
950301618 3:11884344-11884366 AGGTAGCAAAGGATGTTCAAGGG - Intergenic
951037394 3:17948964-17948986 ATGAATCAAAGTTTGTGTAATGG + Intronic
951152619 3:19309678-19309700 ATGAAGGAAAGAATTTTCAAAGG + Intronic
952599614 3:35064578-35064600 ATCAAACAAAGGCTTTTCAAAGG - Intergenic
952654769 3:35771844-35771866 ATAAATTAAAGCATTTTCAAAGG + Intronic
952703909 3:36357152-36357174 ATGGAGCAAAGGCAGTTCAATGG - Intergenic
952978856 3:38719165-38719187 AAGCATCAACGGATGTTCACAGG + Intronic
955897786 3:63718981-63719003 ATAATTTAAAGGATTTTCAAGGG + Intergenic
956379267 3:68648695-68648717 ATGAATCATAGGAAGTTCAGTGG + Intergenic
956601253 3:71025180-71025202 ATGACTCAAAGAATGTTGACTGG + Intronic
959237668 3:103745688-103745710 AGAAATCAAAGGATGATAAATGG - Intergenic
960440273 3:117678317-117678339 ATGAATGAAAGGATGAATAAAGG - Intergenic
960696027 3:120397273-120397295 ATGAAGAAAATGATGTTAAATGG + Intronic
962942960 3:140142285-140142307 TTGAAACAAGGGATGTCCAAGGG + Intronic
963183523 3:142387342-142387364 ATGGATAAAAGGGTGTACAAGGG + Intronic
963425555 3:145118236-145118258 AAGAATCAAAGGAAATACAATGG - Intergenic
963610596 3:147462996-147463018 ATTTATCACAGGATGTTAAATGG + Intronic
964426145 3:156555579-156555601 ATGAAATAAAGGATGTGTAAAGG - Intergenic
966010207 3:175065979-175066001 ATGAGTGAAAGGATGTATAACGG + Intronic
967030774 3:185604694-185604716 ATGAATCAAAGACTCTTAAATGG - Intronic
967900957 3:194451872-194451894 ATGAGTCAAATCCTGTTCAATGG + Intronic
969645135 4:8423779-8423801 TAGATTCAAAGGATCTTCAAAGG - Intronic
969826255 4:9760854-9760876 ATGAAACAGAGGATATGCAAAGG + Intergenic
970359000 4:15288484-15288506 AAGAAGCAAAGGCAGTTCAAGGG + Intergenic
970894176 4:21083417-21083439 ATGAAATTAAGGATCTTCAAAGG + Intronic
974340346 4:60607312-60607334 AAGACACAAAGGATGTTGAAAGG - Intergenic
974551007 4:63374603-63374625 ATGAAGAAAAGGAAGTTTAATGG + Intergenic
974572727 4:63674952-63674974 ATGAATCATAGGATGTTTCTGGG + Intergenic
975681623 4:76882990-76883012 AAGAATCACAGGCTGTTCACAGG + Intergenic
977173267 4:93788671-93788693 ATGATCTAAAGGACGTTCAAGGG + Intergenic
977941504 4:102864414-102864436 CTAAATCAAAGGATGTTTAGTGG + Intronic
982438498 4:155404825-155404847 ATAGATGAAAGGATGTTTAAAGG - Intergenic
982462400 4:155687052-155687074 ATGCATCAAAGCTTGTTTAAGGG - Intronic
985829711 5:2219413-2219435 ATGAATGGATGGATGTTGAATGG - Intergenic
986319561 5:6617828-6617850 AAGCATCAGAGGATGGTCAATGG - Intronic
986374247 5:7114132-7114154 ATGAAGCACAGGAGGATCAAGGG - Intergenic
986591718 5:9377382-9377404 TTGAAGCAAAAGGTGTTCAAAGG - Intronic
987874747 5:23667037-23667059 ATGCATCAATGTATGTTCACTGG + Intergenic
993133938 5:83933149-83933171 ATAAATAAAAGGAGGTTTAACGG - Intergenic
993669380 5:90741820-90741842 ATGCATTAAATAATGTTCAAGGG + Intronic
994704051 5:103177665-103177687 AGGAATCAAAGGATGAACAGTGG + Exonic
994974835 5:106788852-106788874 ATGAATCAAAGAAATTTAAATGG - Intergenic
995044414 5:107629041-107629063 AGGAAGGAAAGAATGTTCAAAGG + Intronic
995327002 5:110901869-110901891 ATGGAGAAAAGGATGTTCAATGG - Intergenic
996302049 5:121999208-121999230 ATGAATCAAAGAGGGTTCAAAGG - Intronic
996601984 5:125274920-125274942 ATTAAACAAAGGATGTAAAATGG - Intergenic
998769745 5:145528876-145528898 AGGAAGCAAATGATGTTTAATGG + Intronic
999211913 5:149896898-149896920 GTGCATCAATGGATGTTAAATGG - Intronic
1000287289 5:159837608-159837630 AAGACTGAAAAGATGTTCAAAGG - Intergenic
1007072904 6:39049449-39049471 ATGAATCAAAGGCTGTGCTGGGG - Intronic
1008351245 6:50492869-50492891 ATGAATGAATAGATGATCAATGG + Intergenic
1009820586 6:68795831-68795853 ATGAAACAAATGCTGTTCTAGGG - Intronic
1010086105 6:71919792-71919814 AAGAATGAAAGGCTGTTCAATGG + Intronic
1011194828 6:84770158-84770180 CTGAATGAAAGGATTTTTAATGG + Intergenic
1012716253 6:102675230-102675252 ATAAATGACAGGATGGTCAAAGG - Intergenic
1014309284 6:119780373-119780395 ATGAATGAATGTAAGTTCAATGG - Intergenic
1016026037 6:139288046-139288068 ATGGAGCATAGCATGTTCAAAGG + Intronic
1016497697 6:144683038-144683060 ATGAAACAAAGTGTGCTCAAGGG + Intronic
1016760920 6:147736342-147736364 AAGAATTAAAGGATGTAAAATGG - Intronic
1019887069 7:3914577-3914599 ATGAAGCTAGGGAAGTTCAAAGG + Intronic
1021079031 7:16341262-16341284 ATGTATCAATGTAAGTTCAATGG + Intronic
1021911170 7:25387043-25387065 AGGAATCAAATGATTTACAATGG + Intergenic
1022648052 7:32249864-32249886 TTGAATTAAGGGATTTTCAAAGG - Intronic
1024088056 7:45913208-45913230 ATGTATCTAAGAATGTTCTAGGG - Intronic
1024341593 7:48269292-48269314 ATGACTCAATGGATTTTGAAAGG + Intronic
1028509150 7:91603427-91603449 TTCAATAAAATGATGTTCAAGGG - Intergenic
1028660476 7:93266729-93266751 ATTAATTAAAGTATGTTAAAAGG - Intronic
1028750155 7:94373844-94373866 ATGAAAGAAATGATGATCAAAGG + Intergenic
1029434229 7:100553153-100553175 AAAAACCAAAAGATGTTCAAGGG + Intronic
1032914818 7:136478082-136478104 ATGAGTCAAAGTATGCTTAAAGG + Intergenic
1032967931 7:137123005-137123027 ATGAATGAAAGTATGTTCAAAGG + Intergenic
1033876803 7:145830646-145830668 AAGAATCAAAGGCAATTCAATGG + Intergenic
1037006119 8:13782530-13782552 AAGAAACGAAAGATGTTCAAAGG - Intergenic
1037183946 8:16039200-16039222 TTGAATTAAAGGAAGTTGAAAGG - Intergenic
1037222204 8:16537319-16537341 ATGAATCTAAGCATTTTCAGTGG - Intronic
1039502569 8:38029741-38029763 ATGGATGGATGGATGTTCAAGGG - Intergenic
1039645170 8:39274173-39274195 ATAAATAAAATGATGTCCAAAGG - Intronic
1039671340 8:39603138-39603160 AAGATTCAAAGGCAGTTCAATGG - Intronic
1040450032 8:47536497-47536519 AAGAAGCAAAGGATATTTAATGG + Intronic
1041594234 8:59628082-59628104 ATGAACCCAAGGAAGCTCAATGG - Intergenic
1041911195 8:63089948-63089970 ATGGAGTAAAGGATGTTGAAAGG + Intergenic
1042443915 8:68861699-68861721 ATTAATAAAAAGATATTCAATGG - Intergenic
1042738456 8:72015984-72016006 TAGAAACAAAGGATGTTAAAAGG + Intronic
1043079087 8:75742373-75742395 GTAAATTAAAGTATGTTCAAGGG - Intergenic
1044028675 8:87207102-87207124 ATAAATCAAAGGAATTTTAAAGG + Intronic
1045332113 8:101164323-101164345 ATGATTCAAAGGAGCTTCAGAGG - Intergenic
1046624922 8:116566314-116566336 ATGGAACAAAGCATTTTCAAAGG + Intergenic
1046859808 8:119077659-119077681 TTAGAGCAAAGGATGTTCAATGG + Intronic
1048324984 8:133432031-133432053 ATGAATAAATGAATGTTCTATGG + Intergenic
1049085288 8:140473773-140473795 ATAAAACAAAGGGTGTTCACAGG + Intergenic
1049894739 9:102642-102664 ATGAGTCGAAGTATGTTCACAGG - Intergenic
1052490671 9:29162573-29162595 ATGAATCAATGGATATGAAAGGG + Intergenic
1054692428 9:68328766-68328788 ATGAGTCGAAGTATGTTCATAGG + Intronic
1054804829 9:69387777-69387799 ACCAATGAAAGGATGTTCCAAGG - Intronic
1055267954 9:74519874-74519896 GTGAATTAAAGAATGATCAACGG - Intronic
1055671260 9:78608273-78608295 ATGAATAAAAAGAGGTTTAAAGG - Intergenic
1058162555 9:101585587-101585609 AGGAATCAAAGGTGGTTCTAAGG - Intronic
1059834461 9:118135501-118135523 ATGAAGAAAGAGATGTTCAATGG + Intergenic
1062190644 9:135246243-135246265 ATGAATAAACGGATAATCAATGG + Intergenic
1185854542 X:3521907-3521929 AAGAATCATATGATGTTTAATGG - Intergenic
1186151173 X:6676229-6676251 ATGAACCAAAGGAGGTGAAATGG + Intergenic
1189138996 X:38581296-38581318 ATGAAGAAAAAGATGTTTAATGG + Intronic
1189194259 X:39139195-39139217 ATGAATAAAAGGAAGTTATAAGG + Intergenic
1189894732 X:45643272-45643294 CTGAATGAAAGGAATTTCAAGGG - Intergenic
1191005747 X:55710041-55710063 ATAAAACAAAGGATGTTGTATGG - Intergenic
1192067509 X:67902264-67902286 ATGAAAAAAAGAATGTTAAAAGG - Intergenic
1199003583 X:142670412-142670434 ATAAATTAAAGCATGTTTAAAGG - Intergenic
1199160147 X:144599617-144599639 ATGAATCAAAGTAAGTTCTTAGG - Intergenic
1199255232 X:145711919-145711941 ATAAATCAAAGGATACTCAGGGG - Intergenic
1200824726 Y:7626017-7626039 CTGAATCATAGCATGTTCAGGGG + Intergenic
1200851482 Y:7888149-7888171 TGGATTCAAAGGATCTTCAAAGG + Intergenic
1201050048 Y:9923665-9923687 ACCAATCAAAGGATGTGCATGGG - Intergenic
1202235329 Y:22705070-22705092 CTGAATCATAGCATGTTCAGGGG - Intergenic
1202307830 Y:23491098-23491120 CTGAATCATAGCATGTTCAGGGG + Intergenic
1202562971 Y:26179488-26179510 CTGAATCATAGCATGTTCAGGGG - Intergenic