ID: 1080597229

View in Genome Browser
Species Human (GRCh38)
Location 11:33784162-33784184
Sequence GCTGAGAGTAGACCAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080597229_1080597234 18 Left 1080597229 11:33784162-33784184 CCCACTTTTGGTCTACTCTCAGC No data
Right 1080597234 11:33784203-33784225 CATATGGACTTTATTTGCAGAGG No data
1080597229_1080597236 24 Left 1080597229 11:33784162-33784184 CCCACTTTTGGTCTACTCTCAGC No data
Right 1080597236 11:33784209-33784231 GACTTTATTTGCAGAGGTATGGG No data
1080597229_1080597232 2 Left 1080597229 11:33784162-33784184 CCCACTTTTGGTCTACTCTCAGC No data
Right 1080597232 11:33784187-33784209 AATCTGCAGTAGAGACCATATGG No data
1080597229_1080597235 23 Left 1080597229 11:33784162-33784184 CCCACTTTTGGTCTACTCTCAGC No data
Right 1080597235 11:33784208-33784230 GGACTTTATTTGCAGAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080597229 Original CRISPR GCTGAGAGTAGACCAAAAGT GGG (reversed) Intergenic
No off target data available for this crispr