ID: 1080607652

View in Genome Browser
Species Human (GRCh38)
Location 11:33877030-33877052
Sequence CTTTCTTTGCTGGACATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080607645_1080607652 8 Left 1080607645 11:33876999-33877021 CCTCAGAGGACAATAGTCAACCA 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1080607652 11:33877030-33877052 CTTTCTTTGCTGGACATAGATGG 0: 1
1: 0
2: 1
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080607652 Original CRISPR CTTTCTTTGCTGGACATAGA TGG Intronic
901648091 1:10727378-10727400 TTTTCTTTTCTGGACTTAAAAGG - Intronic
903395785 1:23000966-23000988 CTTTCCTTGCTGGGCATGGTTGG - Intergenic
905283394 1:36863588-36863610 CATTCTTGCCTGGAAATAGAAGG - Intronic
905361604 1:37424629-37424651 CTCTCTTTTCTGGAAATATAGGG - Intergenic
905871049 1:41404777-41404799 CTTTCTTTCCTTGGCATAAATGG + Intergenic
906830411 1:49025329-49025351 CTTTCTGTGCTGGAGACAGAGGG - Intronic
907188839 1:52632566-52632588 CTTTCTTTGCTGGTCAGTGTGGG + Intergenic
908498261 1:64717070-64717092 CTTTATGTGCTGGGCATTGAGGG - Intergenic
908540915 1:65121228-65121250 CTTTCTTTGCTTGAAGTAGTAGG - Intergenic
908903171 1:68979486-68979508 CTTTCTTTGCTGGGGAGGGAAGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
912174226 1:107138646-107138668 CTTTCTTGGCTTGAGAGAGAAGG + Intergenic
912518424 1:110229951-110229973 CTATCTTTGCTGACCATGGAAGG - Intronic
913113575 1:115677372-115677394 TTTTCTTTGCAGGACAAAGAGGG - Intronic
916632745 1:166634363-166634385 CTTTCTTTGCTGTACAATGTGGG + Intergenic
919120539 1:193334735-193334757 CTTTCTTTACTGGAGACAGAAGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919692200 1:200537875-200537897 CTTACTTTCCTGCAAATAGAAGG - Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
921414857 1:214873968-214873990 CTTATTTTTCTGGAAATAGAAGG + Intergenic
921749753 1:218778596-218778618 TCTTCTTTGCTGAACAGAGAAGG - Intergenic
922993585 1:229938369-229938391 GTTTCTTTGCTTGACATAAGTGG + Intergenic
923322736 1:232851792-232851814 CTTTCTTTTCTGAACTTAGGAGG + Intergenic
1063287768 10:4709071-4709093 CTTTCTCTGCAGGACATGGCAGG + Intergenic
1063364078 10:5479322-5479344 CTTCCTTTGCTTTATATAGAAGG + Intergenic
1063374403 10:5545424-5545446 CTTTCTTTGCTAGACCCAGAAGG + Intergenic
1064559012 10:16577297-16577319 GTTTCATTGCTGGAAAGAGATGG + Intergenic
1068834676 10:61541105-61541127 CTTTCTTTGTTGCAGACAGAAGG - Intergenic
1068844351 10:61655131-61655153 CTTCCTTGACTGGACAAAGAAGG - Intergenic
1070334184 10:75439890-75439912 CTTCCTTTCCTGGGCATGGAAGG + Intronic
1071198799 10:83193389-83193411 TTTTCTTTTTTGAACATAGATGG + Intergenic
1071439042 10:85674068-85674090 CTTTCTCTACTTGACATAGTAGG + Intronic
1072304277 10:94092298-94092320 CTTACTTTATTGGACAAAGAAGG - Intronic
1073848917 10:107591897-107591919 CTTTCCAGGCTGCACATAGAGGG + Intergenic
1073986518 10:109215808-109215830 ATTTCTTTGCTGGAGAAAGCAGG - Intergenic
1074214381 10:111370029-111370051 CTCTCTATGCTGGACATGGTTGG - Intergenic
1076509989 10:131006502-131006524 CTTTCCTTGGTGGACACACATGG - Intergenic
1078118552 11:8481404-8481426 CGTCTTTTGCTGGACATAAATGG - Intronic
1079554130 11:21738782-21738804 CTTTAATTGCTGGACATAAAAGG - Intergenic
1079631084 11:22676261-22676283 CTTTCCTTGATGGAGATAAAAGG - Intronic
1080607652 11:33877030-33877052 CTTTCTTTGCTGGACATAGATGG + Intronic
1082863164 11:57874275-57874297 CCTTCTTTGCTGAACATTGAGGG + Intergenic
1085413309 11:76304630-76304652 TTTTCTCTCCTGGACATGGAGGG - Intergenic
1085991494 11:81852202-81852224 CTTTCTTTGAAGGTCAGAGATGG + Intergenic
1087809860 11:102598870-102598892 CTTTATTTGCTGGACAATCAAGG + Intronic
1089914846 11:122143785-122143807 CATTCTTTGCTGGATGAAGAAGG + Intergenic
1090369576 11:126239143-126239165 CTTTCTTTGTTTGGCAGAGATGG + Intronic
1090445891 11:126764315-126764337 CTTTCTTAGCTAGATACAGATGG + Intronic
1091079336 11:132651996-132652018 CGTTGTTTGTTGGAGATAGATGG - Intronic
1091182753 11:133621624-133621646 CTTTCTTTACTTTACATTGAAGG - Intergenic
1095792181 12:46179572-46179594 CTGTATTTGCTGGATATATAAGG + Intergenic
1097543468 12:60969572-60969594 CTTGCTTTGGAGGACAAAGAAGG + Intergenic
1099435669 12:82642466-82642488 ATGTCTTTGCAGGACATGGATGG + Intergenic
1099520591 12:83655981-83656003 CTTTCCTTGCTGGGGATAGAAGG + Intergenic
1099627563 12:85094258-85094280 CTTGCTTTCCTGCAAATAGATGG - Intronic
1099674777 12:85744476-85744498 CTTACTTTTATGGAAATAGAAGG + Intergenic
1100902253 12:99254935-99254957 ATTTCTTTCATGAACATAGATGG - Intronic
1101962462 12:109260161-109260183 TTTTCTTTGCTGGAAATGGTGGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106989871 13:35406020-35406042 CTTTTTTTTCTGGAGATGGAGGG - Intronic
1107365351 13:39666995-39667017 GTTTCTTTGCAAGACGTAGAAGG + Intronic
1108196088 13:47996711-47996733 TTTTCTTTGCTTAAAATAGAAGG - Intronic
1109865518 13:68258692-68258714 CTTTCTTTTCTGGACATTCCAGG - Intergenic
1110315044 13:74096387-74096409 TTTTCTGTGCTGGAGAGAGAGGG - Intronic
1110394344 13:75012262-75012284 CTGTCTTTTCTGGGCATCGAGGG + Intergenic
1110557607 13:76877938-76877960 GTTTTTTTGGTGGGCATAGAGGG + Intergenic
1113942050 13:114023413-114023435 CTTCCCATGCTGGACAGAGAAGG - Intronic
1114578067 14:23731190-23731212 CTCTTTCTGCTGGACATAGGGGG + Intergenic
1119881896 14:78106271-78106293 TTTTCTTTTCTGGACAGAGTTGG + Intergenic
1120801182 14:88690469-88690491 CTGTCTTTTCTCAACATAGAAGG + Intronic
1120975170 14:90242031-90242053 CTTTCTTGGCTGGGCACAGTGGG - Intergenic
1121685121 14:95830153-95830175 CTTCCTTTAATGGACAAAGAGGG - Intergenic
1122430870 14:101642048-101642070 ATTTCTTTTCTGGAACTAGATGG - Intergenic
1123131719 14:105992165-105992187 ATGTATTTGCTGGACATTGATGG + Intergenic
1123581950 15:21723356-21723378 ATGTATTTGCTGGACATTGATGG + Intergenic
1123618599 15:22165956-22165978 ATGTATTTGCTGGACATTGATGG + Intergenic
1125887855 15:43241997-43242019 CTGTCATTGCTGGACATGAAGGG - Intronic
1127783389 15:62335438-62335460 CTTTCCTTTCTGTATATAGAAGG + Intergenic
1128128083 15:65207523-65207545 GTTCCTTGGCTGGACAGAGATGG + Intronic
1129328116 15:74812703-74812725 ATGTCTATGCTGGAGATAGAGGG + Exonic
1130192067 15:81746990-81747012 CTTTCTTTGCTAGAGACAGATGG + Intergenic
1130206959 15:81886001-81886023 CTTTCTCTGCTTCACACAGAAGG - Intergenic
1131387970 15:92023252-92023274 CTTTCTTTACAGAACATACAAGG + Intronic
1132051514 15:98611389-98611411 ATTTCTCTGCTGGATAGAGAGGG + Intergenic
1138281612 16:55776181-55776203 CATCCTTTGCAAGACATAGATGG - Intergenic
1138615106 16:58158906-58158928 CTTGCTATGCTGGACCTGGAAGG - Intronic
1141319464 16:82993874-82993896 CGTTCTTTGGTGCACAGAGAGGG + Intronic
1141912441 16:87069103-87069125 CTTTCTCTGCTGGACTCAGGAGG - Intergenic
1144404185 17:14936633-14936655 CTATCTTGGCTGGACATGAAGGG + Intergenic
1145267308 17:21386008-21386030 CTTTCTTTACTGGACCTGGTTGG - Intronic
1145771027 17:27493310-27493332 CTTGCTTTTCAGGACAGAGAGGG + Intronic
1148908152 17:50924599-50924621 CTTTTTTTGCTGGGGAGAGATGG + Intergenic
1152990405 18:358411-358433 CTTGTTTTCCTGGAAATAGATGG + Intronic
1153171073 18:2316664-2316686 CTTTATTTTTTGGACAGAGATGG - Intergenic
1154375133 18:13802897-13802919 CTCTCTTGGCTGTACACAGATGG + Intergenic
1155107105 18:22678211-22678233 CTTTCCTTGCTGGAGAAACATGG + Intergenic
1155107378 18:22680850-22680872 CTTTCCTTGCAGGAGAAAGATGG + Intergenic
1159280659 18:66280534-66280556 CTTTGTTTTCTGGCCAGAGAAGG + Intergenic
1160117507 18:76094963-76094985 GTTTCTTTGCTGCATATAGTAGG - Intergenic
1160482781 18:79257729-79257751 ATGTGTTTGCTGGACAGAGATGG - Intronic
1162593633 19:11610218-11610240 CGTTCTTTCCTGGACATGAAGGG + Intronic
1162611343 19:11756557-11756579 CTTACTTTAATGGACATAAAAGG - Intergenic
1162976287 19:14208421-14208443 CTCTCTTCCCTGGACATATAGGG - Intergenic
1163117984 19:15199947-15199969 CTTTCTTTGCCAGACAAAGCGGG - Intronic
1163266758 19:16226706-16226728 CATCCTTCCCTGGACATAGAAGG + Intronic
927612325 2:24553706-24553728 CATACTTTGATGAACATAGATGG - Intronic
929023558 2:37577492-37577514 ATTTCTTTGCTGGAGGCAGAGGG - Intergenic
929242818 2:39669219-39669241 TTTTCTTCTCTGGACCTAGAGGG + Intronic
930048388 2:47194001-47194023 CCTTCTTTGCTGGTCTCAGAAGG + Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935110151 2:100085674-100085696 CTTTCTCTGCTGTACATTGAGGG + Intronic
936124823 2:109779532-109779554 CTTTCTCTGCTGTACATTGAGGG - Intergenic
936219868 2:110591934-110591956 CTTTCTCTGCTGTACATTGAGGG + Intergenic
939021897 2:136967206-136967228 CTTTCTTTGAAGGACTTTGAAGG - Intronic
939672535 2:145030793-145030815 CTATCTTTGCTGGAACTAGAGGG - Intergenic
939885209 2:147673839-147673861 CTTTCTATGGTAGACATTGAGGG + Intergenic
940069584 2:149670945-149670967 CTTTCTTTTCTGGACAGGGCAGG + Intergenic
940912346 2:159219700-159219722 CTTTCTTCTCTAGACAAAGAGGG + Exonic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
943334528 2:186597896-186597918 TTTCCTTCCCTGGACATAGAGGG - Intronic
943454353 2:188085091-188085113 CTTTCTTTTCTGGACTTTTAAGG - Intergenic
948271559 2:236677900-236677922 CTTTCTCTCCTGGAAACAGATGG + Intergenic
1169171968 20:3471983-3472005 CTTTGTTGGCTGGAGATAAAAGG + Intronic
1169911616 20:10651832-10651854 CTTTCTTTCCTAGACACAGCAGG - Intronic
1170002228 20:11627337-11627359 CTTTCTCTTGTGGACATACATGG - Intergenic
1170208356 20:13823367-13823389 CTATCCATGCTGGACATATAAGG - Intergenic
1170489619 20:16859366-16859388 TTGTCTTTGCTGGACCTTGAAGG + Intergenic
1171003330 20:21437221-21437243 ATTTCTTTGCTAGACATATTTGG + Intergenic
1172592487 20:36127562-36127584 CTAGCTTTCCTGGACCTAGAAGG - Intronic
1174435882 20:50506439-50506461 CTTACTTAGCTTGACATACAGGG + Intergenic
1175816071 20:61883849-61883871 CATTCTCTGCTGGGCACAGAGGG - Intronic
1177744361 21:25193423-25193445 CTTTCTCTGATGGAAAGAGAGGG + Intergenic
1178023073 21:28432193-28432215 CTTTATTTGCAAGACATACATGG + Intergenic
1178024450 21:28450631-28450653 CTATCTTTGCTGGACATAAACGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1182077874 22:27507133-27507155 CTTCCTTAGCTGGACAATGAGGG - Intergenic
1183175003 22:36216890-36216912 CTTTCTGTGGGGGACATAGAGGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949161240 3:884836-884858 CTTTATTTGATGTACACAGAGGG + Intergenic
949398360 3:3638917-3638939 CTTACTCTGCTGGATATGGAAGG + Intergenic
950182461 3:10925482-10925504 TTTTAGTTGCTGCACATAGAAGG - Intronic
951986140 3:28623251-28623273 CATTCTTTTCTGGTCACAGACGG + Intergenic
953656326 3:44857702-44857724 CTTTCCTTCCTGGACATGGTTGG - Intronic
958751207 3:98194621-98194643 CTTTCCTTCCTGGGCATAGTTGG + Intronic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
963532900 3:146493646-146493668 CTTTTTTTGTTTGTCATAGATGG - Intronic
970251174 4:14117648-14117670 TTTTCTTTGCTGGCAATACAAGG + Intergenic
970598793 4:17624459-17624481 CTTTTTTTTTTTGACATAGAAGG + Exonic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
971768018 4:30859401-30859423 CTTTCTCTGATGCACATACAGGG - Intronic
972327947 4:38035813-38035835 TTTCCTTTGTTGCACATAGAGGG + Intronic
972431063 4:38982782-38982804 CTCTTTTTGATGGACATATAGGG + Intronic
972937860 4:44161318-44161340 TTTTGTTTCCTGGACAAAGAAGG - Intergenic
974069905 4:57114060-57114082 CTGTACTGGCTGGACATAGAGGG - Intergenic
975605828 4:76153552-76153574 CTTTCTTTTCAGTACATAAAGGG - Intergenic
976988685 4:91335577-91335599 TTCCCTTTTCTGGACATAGAAGG + Intronic
978160501 4:105541399-105541421 TGTTGTTTGCTGGACATAGCAGG - Intergenic
978249696 4:106615652-106615674 CTTTATTGGGTGGCCATAGAAGG + Intergenic
978541101 4:109816821-109816843 CTTTCTTTTCTGTACAGACAGGG - Intronic
979484623 4:121256424-121256446 CTTTCTTTTCTGAAATTAGATGG + Intergenic
979653572 4:123164594-123164616 CATTTTTTGCTAGACATAGTGGG - Intronic
981073239 4:140567305-140567327 CTTTCTTTGCTTCAAACAGAAGG + Intronic
982345382 4:154352122-154352144 CTTTTATTGCTGGACAAACATGG - Intronic
983105467 4:163681308-163681330 CTTACTTGGCTTGAGATAGATGG - Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
984098848 4:175463626-175463648 CTTTCCTTCCTGGGCATAGTTGG - Intergenic
984855203 4:184189182-184189204 CTTCCTTTCCTGGCCATGGAAGG + Intronic
984912290 4:184685465-184685487 CTTTCTTTGGTGAATAAAGATGG + Exonic
985306001 4:188540905-188540927 TTTTCTTTGATAGGCATAGAGGG + Intergenic
986459640 5:7957217-7957239 CTCTCTGTCCTGGACATAGGAGG - Intergenic
989203037 5:38784657-38784679 CTTCCTATGGTGGACATAAAGGG - Intergenic
992425916 5:76657337-76657359 GCATCTTTGCTGGAAATAGAAGG + Intronic
993107584 5:83616937-83616959 CATACTTTGCAGGACTTAGATGG + Intergenic
995239069 5:109865399-109865421 CTTTGTAGGCTGGAAATAGAAGG - Intronic
996551935 5:124740146-124740168 TTTGCTTTGCTGGAGAGAGAAGG - Intronic
997351163 5:133232471-133232493 CTATATTTGGTGGACACAGATGG - Intronic
999261158 5:150239728-150239750 CTTTCTTTTCTGGAAAAACAAGG + Exonic
999300712 5:150488523-150488545 GTTGCTTTGCTGGACATTGAGGG + Intronic
1001737849 5:174021523-174021545 CTTTCTTTGGTGGAGATGTATGG + Intergenic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1002342001 5:178522984-178523006 CATTCAGTTCTGGACATAGATGG - Intronic
1002461995 5:179378501-179378523 CTTTCTTAGCCTGACATACAAGG + Intergenic
1007107555 6:39294195-39294217 CTGTCCTTGCTGGGCACAGATGG + Intergenic
1007915236 6:45555409-45555431 ATTTCACTGCTGGAGATAGATGG - Intronic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008660958 6:53667259-53667281 CTTTCTGTGCTGGAGATCTATGG - Intergenic
1010583283 6:77626142-77626164 CTGTTTTTGCTGGAAATAAATGG - Intergenic
1011370057 6:86627326-86627348 GTTTCTTTGCAGGAAATACAGGG + Intergenic
1011605343 6:89099160-89099182 TTTACTTTGCTAGACATATAGGG + Intronic
1012324312 6:97895986-97896008 CTTTCTTTGCTTGCCCTAGTAGG + Intergenic
1016101699 6:140109743-140109765 ATTTCTTTGAAGGACATAAATGG + Intergenic
1016912094 6:149209193-149209215 TCTTATTTCCTGGACATAGAAGG + Intergenic
1018695928 6:166391342-166391364 CTTGCTTTGCAGGAAAGAGAGGG + Intergenic
1021405507 7:20262805-20262827 CTTGCTTTCCTGGGCATAAATGG - Intergenic
1022572589 7:31469220-31469242 CTTTCCTTCCTGGGCATAGTTGG - Intergenic
1023665801 7:42522182-42522204 CTTGCTTTGCTTAACAAAGAAGG + Intergenic
1024478313 7:49837967-49837989 CTTTCTTCCCTGTACATTGATGG + Intronic
1024551157 7:50563367-50563389 CTTGCTTTATTGGACATATATGG - Intronic
1024661429 7:51498870-51498892 CTTTCTTTGGTGAATAAAGAGGG + Intergenic
1027908556 7:84217178-84217200 CTCTCTTTGATAGACTTAGATGG + Intronic
1028466022 7:91152914-91152936 CTTTCTGTTCTTGACATACATGG - Intronic
1029982700 7:104894021-104894043 CTTTCTCTGCTGTGCACAGATGG - Intronic
1030397757 7:109009612-109009634 CTTTCTTTGTTGAATATATAAGG - Intergenic
1030815256 7:114028281-114028303 CTTTTTTTTCAGGACATAGAAGG - Intronic
1036639709 8:10574955-10574977 CTTTCCTTCCTGGGCATAGTTGG + Intergenic
1036732543 8:11278680-11278702 CTTTCTTTGCTTAACTTATAAGG - Intergenic
1036772120 8:11586500-11586522 TATTTTTTGCTGGAAATAGATGG + Intergenic
1037763759 8:21759014-21759036 CTTTCTTTCCTGCACACAGCTGG - Intronic
1038285271 8:26200758-26200780 CTTTCTTTCCTGCAACTAGATGG - Intergenic
1041369549 8:57144010-57144032 CTTTCTTTGCTGAATAAAAATGG - Intergenic
1041404963 8:57488180-57488202 GTTTTTTTGTTGGACATGGATGG + Intergenic
1046021918 8:108675474-108675496 GTTTATTCGATGGACATAGATGG - Intronic
1048204731 8:132406241-132406263 CTTTCTTTGCTGGATCAAGCGGG + Intronic
1048752092 8:137689884-137689906 CTTTCTTTCCCTGGCATAGAAGG + Intergenic
1053085416 9:35216247-35216269 CTTTCTTTTCTGGACCAGGATGG + Intronic
1053572620 9:39325491-39325513 ATTTCTTTGCTGCACATCAATGG - Intergenic
1053623961 9:39849715-39849737 ATTTCTTTGCTGCACATCAATGG - Intergenic
1053880908 9:42593514-42593536 ATTTCTTTGCTGCACATCAATGG + Intergenic
1053891760 9:42700812-42700834 ATTTCTTTGCTGCACATCAATGG - Intergenic
1054094180 9:60884203-60884225 ATTTCTTTGCTGCACATCAATGG - Intergenic
1054124525 9:61293520-61293542 ATTTCTTTGCTGCACATCAATGG + Intergenic
1054219936 9:62400985-62401007 ATTTCTTTGCTGCACATCAATGG + Intergenic
1054230779 9:62508187-62508209 ATTTCTTTGCTGCACATCAATGG - Intergenic
1054798471 9:69324805-69324827 CTCTCGTGGCTGGACAGAGAAGG + Intronic
1055902183 9:81253374-81253396 TTTTCTTAGCTGTACATTGAAGG - Intergenic
1057517389 9:95733604-95733626 CTTTCTTTAATGGAAAAAGAAGG - Intergenic
1057575435 9:96238680-96238702 TTTTCTTTCCTGGAGATAGTGGG + Intronic
1058128255 9:101221301-101221323 TTTTCTTTGCTTGACATTGCTGG + Intronic
1060316793 9:122519108-122519130 TTCTCTCTGCTGGAAATAGAGGG - Intergenic
1186098958 X:6134527-6134549 CTTTCCTTGCAGAACATACAGGG - Intronic
1186154051 X:6707481-6707503 CTTGCTTTCCTGCAAATAGACGG + Intergenic
1186806278 X:13143323-13143345 CCTTCATTGATGGACAGAGAAGG + Intergenic
1187721131 X:22151846-22151868 CTTTCTGTTCTGGACATCGGTGG - Intronic
1188081247 X:25843496-25843518 CTTACTTAATTGGACATAGAAGG + Intergenic
1188200721 X:27291160-27291182 CTTTCTTTCCTGGGCATGGTTGG - Intergenic
1188692613 X:33149191-33149213 CTTTCTTTCCTGCAACTAGACGG + Intronic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1196050983 X:111303868-111303890 TTTTCTTTGCTGGTCACATATGG + Intronic
1197715010 X:129700315-129700337 CTTACTGTGCTGGACTGAGATGG + Intergenic
1198179345 X:134190360-134190382 CTTAGTTTGCAGGAAATAGAGGG + Intergenic
1198551610 X:137751206-137751228 TTTTCTTTCCTGGACTTATAAGG + Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201334033 Y:12859885-12859907 CCTTCTTTCCTGGATATATAAGG + Exonic
1201786144 Y:17781569-17781591 CTTACTTTGTTGGACAGAGGTGG - Intergenic
1201815409 Y:18124419-18124441 CTTACTTTGTTGGACAGAGGTGG + Intergenic
1201982797 Y:19925596-19925618 ATTTCTTTCCTGGAGATAAAAGG - Intergenic
1202076313 Y:21041108-21041130 CTTTCCTTCCTGGTCATAGTTGG - Intergenic
1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202224298 Y:22585515-22585537 CTTTCCTTGCTGGAGATGGAGGG - Intergenic
1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202551952 Y:26059912-26059934 CTTTCCTTGCTGGAGATGGAGGG - Intergenic