ID: 1080610897

View in Genome Browser
Species Human (GRCh38)
Location 11:33902614-33902636
Sequence ATAAGGCATCAGGAAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080610897_1080610901 11 Left 1080610897 11:33902614-33902636 CCAGGTTTTTCCTGATGCCTTAT No data
Right 1080610901 11:33902648-33902670 ATATCTCCACCTGCCAATGAAGG No data
1080610897_1080610904 22 Left 1080610897 11:33902614-33902636 CCAGGTTTTTCCTGATGCCTTAT No data
Right 1080610904 11:33902659-33902681 TGCCAATGAAGGAGTTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080610897 Original CRISPR ATAAGGCATCAGGAAAAACC TGG (reversed) Intergenic
No off target data available for this crispr