ID: 1080614866

View in Genome Browser
Species Human (GRCh38)
Location 11:33937132-33937154
Sequence CTATGAGGCCCTTTATCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080614866_1080614873 18 Left 1080614866 11:33937132-33937154 CCCGGTGATAAAGGGCCTCATAG No data
Right 1080614873 11:33937173-33937195 ACTTGATCCTGAAGGCAACGAGG No data
1080614866_1080614874 19 Left 1080614866 11:33937132-33937154 CCCGGTGATAAAGGGCCTCATAG No data
Right 1080614874 11:33937174-33937196 CTTGATCCTGAAGGCAACGAGGG No data
1080614866_1080614870 -5 Left 1080614866 11:33937132-33937154 CCCGGTGATAAAGGGCCTCATAG No data
Right 1080614870 11:33937150-33937172 CATAGACCAGATTAAGGAATTGG No data
1080614866_1080614872 10 Left 1080614866 11:33937132-33937154 CCCGGTGATAAAGGGCCTCATAG No data
Right 1080614872 11:33937165-33937187 GGAATTGGACTTGATCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080614866 Original CRISPR CTATGAGGCCCTTTATCACC GGG (reversed) Intergenic
No off target data available for this crispr