ID: 1080618768

View in Genome Browser
Species Human (GRCh38)
Location 11:33968742-33968764
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080618762_1080618768 11 Left 1080618762 11:33968708-33968730 CCAAGTGTGGTGGCTCATGCCTG 0: 366
1: 7263
2: 34068
3: 95319
4: 172242
Right 1080618768 11:33968742-33968764 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1080618764_1080618768 -8 Left 1080618764 11:33968727-33968749 CCTGTAATCTCAACACTTTGGAA 0: 87
1: 3449
2: 53084
3: 344224
4: 244167
Right 1080618768 11:33968742-33968764 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080618768 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr