ID: 1080631841

View in Genome Browser
Species Human (GRCh38)
Location 11:34084557-34084579
Sequence AAGTTGTGCCATGTATCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080631839_1080631841 -4 Left 1080631839 11:34084538-34084560 CCGAAGTCTGCTCATACTCAAGT 0: 1
1: 1
2: 32
3: 93
4: 454
Right 1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG 0: 1
1: 0
2: 2
3: 5
4: 123
1080631836_1080631841 29 Left 1080631836 11:34084505-34084527 CCAGGGGCATTGGTTTTAGGACA 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG 0: 1
1: 0
2: 2
3: 5
4: 123
1080631838_1080631841 3 Left 1080631838 11:34084531-34084553 CCACACACCGAAGTCTGCTCATA 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG 0: 1
1: 0
2: 2
3: 5
4: 123
1080631837_1080631841 4 Left 1080631837 11:34084530-34084552 CCCACACACCGAAGTCTGCTCAT 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG 0: 1
1: 0
2: 2
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080631841 Original CRISPR AAGTTGTGCCATGTATCTGC GGG Intronic
906072288 1:43025806-43025828 AAGTGGTGACTTGCATCTGCTGG + Intergenic
909919938 1:81368506-81368528 CATATTTGCCATGTATCTGCTGG + Intronic
910221374 1:84892818-84892840 AAGTTGTGCCATACACCCGCCGG + Intronic
919116019 1:193281451-193281473 AAGTTGTCTCCTGTATCTACAGG + Intergenic
921792384 1:219305077-219305099 AAGTTGTGCCATGTCACTGAGGG + Intergenic
922391221 1:225144428-225144450 AAGTTGTGCTATGTGTCTCAAGG + Intronic
923534255 1:234836698-234836720 AAGTATTGCCATGTGTCTGGGGG - Intergenic
1062851968 10:750964-750986 CAGTTGTCCCATTTACCTGCAGG + Intergenic
1064371345 10:14754276-14754298 AATTTGTGAAATGCATCTGCAGG + Intronic
1069729947 10:70603989-70604011 AAGTCCTGCAAAGTATCTGCGGG + Intergenic
1072142865 10:92605392-92605414 ATTTTGTGCCAGGTATCTACTGG + Intronic
1073171249 10:101510632-101510654 AAGTTTTGCCTTGTTTCTCCTGG + Intronic
1075941901 10:126396913-126396935 AAGTGGTGCCATGTGACTGGAGG - Intergenic
1079030976 11:16986484-16986506 AAGGTGTGACATGGTTCTGCTGG - Intronic
1079611255 11:22435406-22435428 AAGTTCTGAGATGTATGTGCAGG - Intergenic
1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG + Intronic
1080772520 11:35354864-35354886 AAGATGTGTCATGTTTCTGTTGG - Intronic
1081958095 11:47111166-47111188 GATGAGTGCCATGTATCTGCTGG - Intronic
1083458641 11:62796394-62796416 CAGGTGTGCCCTGTATCTGCTGG + Intronic
1084686808 11:70700881-70700903 ATGTTGGGCCATGCATGTGCAGG + Intronic
1085205490 11:74729726-74729748 AGGCTGTGCCATGTATGTCCTGG + Intronic
1085982580 11:81743208-81743230 AAGATGTACCAAGTATCAGCAGG - Intergenic
1086246602 11:84760854-84760876 GAGTTGGGCCACGTAGCTGCCGG - Intronic
1092337733 12:7648565-7648587 AAGTCATGCAATGTCTCTGCAGG + Intergenic
1093450421 12:19307114-19307136 AAGTTGAAGCATGTAGCTGCTGG + Intronic
1093669596 12:21857968-21857990 AAGGTGAGCAATGTATCTTCAGG + Intronic
1094406502 12:30121730-30121752 TAGTTTTGCCATCTATCTGTAGG - Intergenic
1098032423 12:66268235-66268257 ATGTAGTGGCATGTGTCTGCTGG - Intergenic
1098481772 12:70970025-70970047 AAGTTCTGGGATGTATGTGCAGG - Intergenic
1098892131 12:76020176-76020198 AAGTCGTGCCAGGTAGCTGCCGG - Intergenic
1100502882 12:95191535-95191557 AATTTGTGCCAGGTATCTGCTGG + Intronic
1113190435 13:107739293-107739315 AAGTTGTGGGATGCATGTGCAGG - Intronic
1119462667 14:74821453-74821475 AGGCTGTGCCACATATCTGCTGG - Intronic
1119470234 14:74892618-74892640 AAGTTGAGCCAGTTATCTGATGG + Intronic
1121167966 14:91825741-91825763 TAGATATGGCATGTATCTGCAGG - Intronic
1128389469 15:67173393-67173415 AGGTTGTGCCATGTGTGAGCGGG + Intronic
1131057326 15:89383411-89383433 AAGTCGTGGCTTGAATCTGCAGG + Intergenic
1132815299 16:1823037-1823059 GAGTTGTGCTCTGTGTCTGCAGG - Exonic
1135749571 16:25046228-25046250 AAGTTCTGCTATGTAGCTGGTGG - Intergenic
1135935329 16:26775045-26775067 AAGTAGTGGCATGTAACTGGGGG - Intergenic
1139153885 16:64417727-64417749 AAGTAGTGCCAAGTATTTGTGGG - Intergenic
1140599404 16:76457399-76457421 AAGTTGTGCCATGTTTGTGGGGG - Intronic
1142885253 17:2908633-2908655 TGGTTGTCCCATGTATCTACTGG - Intronic
1149714528 17:58775484-58775506 AATATCTGCCATGTAACTGCTGG - Intronic
1153452828 18:5248618-5248640 ATGTTTTTCAATGTATCTGCTGG + Intergenic
1153918355 18:9766035-9766057 AATTTGTGCCATATTTCTGTGGG + Intronic
1155552323 18:26977810-26977832 AAGTGGTGACATTTATATGCAGG + Intronic
1159366116 18:67467539-67467561 AAGTTGTACCAGGTATTTCCAGG - Intergenic
1160857438 19:1223861-1223883 GAGTTTTGCAGTGTATCTGCAGG + Intronic
1164905755 19:31966645-31966667 GAGTGGGGCCATGTACCTGCCGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166729685 19:45052091-45052113 AAGCTCGGCCATGTACCTGCAGG - Exonic
1167513776 19:49910829-49910851 CAGTGGTGCCATCTATCAGCAGG + Intronic
927720996 2:25382075-25382097 AGGCTGTGCCATTTATCAGCTGG + Intronic
928205530 2:29280720-29280742 AAGTTCTGGCATGTATCAGGTGG + Intronic
932362939 2:71124681-71124703 AAGTTTTTCCATTTATCTCCTGG - Intronic
933475463 2:82784401-82784423 TAGTTGTTCCATGGTTCTGCAGG + Intergenic
935736205 2:106108443-106108465 AATTTGTGCCAAGTCCCTGCAGG - Intronic
938626495 2:133114786-133114808 AAGTTGTTCATTGTATCTACAGG + Intronic
940023652 2:149181973-149181995 GAATTCTGCCGTGTATCTGCAGG + Intronic
941333299 2:164207574-164207596 AAGTTGCCCCCTGTATCTGGTGG + Intergenic
942205048 2:173611859-173611881 AAGCTGTACCATGTATCAGTTGG - Intergenic
942482524 2:176404490-176404512 AAATTGTGTCATGGTTCTGCGGG + Intergenic
1172254380 20:33504186-33504208 ACGTTGTGTCATGTATCTATAGG + Intronic
1173538778 20:43835935-43835957 GAGCTGTGCCATGGATTTGCTGG - Intergenic
1177177097 21:17712052-17712074 TAATTCTGACATGTATCTGCAGG + Intergenic
1177423525 21:20893497-20893519 AACTTGTTCCTTGTATCTTCAGG - Intergenic
1178346515 21:31833261-31833283 AAGTTGAGTCATCTACCTGCAGG + Intergenic
1178948942 21:36970107-36970129 AAGTTCTGCCATGTATTTAATGG - Intronic
1180792841 22:18586166-18586188 ACTTTGTGCCATGTATAAGCTGG - Intergenic
1181228895 22:21409153-21409175 ACTTTGTGCCATGTATAAGCTGG + Intergenic
1181249756 22:21525712-21525734 ACTTTGTGCCATGTATAAGCTGG - Intergenic
949893399 3:8750177-8750199 AAGTGATGCCTTGTAGCTGCAGG - Intronic
951016365 3:17736664-17736686 AACTTCTGCCAGGTAGCTGCTGG + Intronic
953382838 3:42487007-42487029 AAGCTGGGCCATTTATCTGTGGG - Intergenic
956274494 3:67483517-67483539 AAATTATGCAATATATCTGCTGG - Intronic
960697514 3:120410608-120410630 GAGTTGTGCCTTCTATTTGCTGG + Intronic
962231678 3:133671020-133671042 AAATTGTGCCAAGTATCTTAAGG - Intergenic
964548030 3:157856790-157856812 TAGATGTGCCATGTACCTCCAGG - Intergenic
966912679 3:184568353-184568375 CCGTCCTGCCATGTATCTGCAGG - Intronic
970870980 4:20816516-20816538 GAGTTGTGCCAGATACCTGCTGG - Intronic
971945205 4:33266278-33266300 TAATTGTGTCATGTTTCTGCAGG - Intergenic
974372202 4:61032132-61032154 CAGTTGTCCCTTGTATCTGTGGG - Intergenic
977324535 4:95558170-95558192 AATTTATGGCATGTTTCTGCAGG - Intergenic
979648098 4:123095527-123095549 AAACTGTGCCATGAATGTGCTGG + Intronic
979783386 4:124684465-124684487 CAGATGAGCCATGTATGTGCAGG - Intronic
983175047 4:164578417-164578439 AGGGTGTGCTCTGTATCTGCAGG + Intergenic
984040411 4:174726190-174726212 AAGGTATGCCTTGTTTCTGCAGG + Intronic
984250326 4:177324375-177324397 AGGTTGGGCCATGAATCTCCTGG + Intronic
984523483 4:180828009-180828031 AAGTTCTGCCAGGTCTCGGCTGG - Intergenic
985562563 5:597522-597544 AAGTTGTCAGATGTATATGCAGG - Intergenic
986597702 5:9440831-9440853 AATTTCTGCCATGTATCTGCAGG - Intronic
987014743 5:13806603-13806625 AATTTATGACATGTATCTTCTGG + Intronic
988909546 5:35825775-35825797 AGGTTGTGCAATGTGTTTGCAGG - Intergenic
988982649 5:36586976-36586998 AAGTTGAGCCATCTGGCTGCTGG + Intergenic
992808782 5:80364773-80364795 AAGTTCTGGCATATATGTGCAGG + Intergenic
993736802 5:91487109-91487131 CAGATGTGCCATGTTTCTTCAGG - Intergenic
996725975 5:126673695-126673717 AAGCTGTGCCCTGTCTGTGCGGG - Intergenic
1002792149 6:444686-444708 AAGTTGTGCCACTGATCGGCTGG + Intergenic
1004557153 6:16710245-16710267 AAGATATGCAATGTCTCTGCAGG + Intronic
1005792351 6:29316924-29316946 AAGTTGTGTCATGTGTCTTTAGG - Intergenic
1007714063 6:43844198-43844220 ATGTTGTGGCATGTATCAGTAGG + Intergenic
1019191406 6:170253170-170253192 AAGGTGTGCCGTGTTTCAGCAGG - Intergenic
1020868832 7:13602227-13602249 AAGCTATGCCATGTAACAGCAGG - Intergenic
1022541884 7:31145466-31145488 AAGGTTTTCCATGTATCTGAAGG + Intergenic
1023831746 7:44042835-44042857 AAGTTATACCATGTATGTCCTGG - Intergenic
1024142930 7:46480525-46480547 AAGTTCTGACATGTCTCTGGTGG + Intergenic
1024475567 7:49804858-49804880 AATTTGTGCCATGTGTCTTATGG - Intronic
1029318592 7:99736855-99736877 GTGTTGTGCCAGGTATGTGCCGG + Intergenic
1030270937 7:107667559-107667581 AAGTTTTGCCATGAATCAGAGGG + Intronic
1030504358 7:110400417-110400439 AAGTTGGGCTATGTATCTCTTGG - Intergenic
1030567856 7:111182760-111182782 ACATTGTGCCATATATCTGTAGG - Intronic
1035857154 8:2987902-2987924 AAGTTCTGCCATACATGTGCAGG + Intronic
1036418722 8:8575644-8575666 AAGTTCAGTCATGTAGCTGCTGG + Intergenic
1038878297 8:31577266-31577288 GAGTAGTTCCATGTATCTTCTGG - Intergenic
1040449082 8:47525975-47525997 AAGTTTTGCCAGGTATCTTAAGG - Intronic
1041635666 8:60139907-60139929 AAGCTGTTCCATGTTTCTGAGGG - Intergenic
1045167264 8:99620673-99620695 AAGAAGTGCCATGTGTCAGCTGG + Intronic
1046863708 8:119122898-119122920 AAGTTGTGTCTTTAATCTGCAGG - Intergenic
1048659584 8:136583291-136583313 AAGTTGAGCCATACATGTGCAGG + Intergenic
1055358895 9:75467532-75467554 TTGTTATGCCATGTAGCTGCAGG - Intergenic
1056339878 9:85617831-85617853 AAGTTGTTAAATGTATGTGCAGG - Intronic
1061181191 9:129026231-129026253 AAGTTGTTTCTTGTACCTGCAGG + Intronic
1188183793 X:27088823-27088845 AAGTTCTGCCATCTGTTTGCTGG + Intergenic
1192680711 X:73250965-73250987 AAGCTGGGCAATGTCTCTGCTGG - Intergenic
1193872053 X:86811271-86811293 AAGTTGTGCCATTCATTTGTGGG - Intronic
1194349541 X:92808927-92808949 AAGTTGTGCCTTGATGCTGCAGG + Intergenic
1194574228 X:95592334-95592356 TAGTTGTACCATGCATCTGTAGG + Intergenic
1200657862 Y:5925528-5925550 AAGTTGTGCCTTGATGCTGCAGG + Intergenic
1201608924 Y:15818601-15818623 AAGTTGTTACATGAATCTGAGGG - Intergenic
1202062105 Y:20898901-20898923 AAGCTGTGCCCTGTCTGTGCAGG + Intergenic