ID: 1080633459

View in Genome Browser
Species Human (GRCh38)
Location 11:34103003-34103025
Sequence CCTAGTGCTTGGCATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080633459_1080633463 5 Left 1080633459 11:34103003-34103025 CCAGCATCATGCCAAGCACTAGG No data
Right 1080633463 11:34103031-34103053 AGTGGTGACAAAAATTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080633459 Original CRISPR CCTAGTGCTTGGCATGATGC TGG (reversed) Intergenic
No off target data available for this crispr