ID: 1080635273

View in Genome Browser
Species Human (GRCh38)
Location 11:34118255-34118277
Sequence GGGCCTCCATGGTGGCAACG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080635273_1080635292 30 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635292 11:34118308-34118330 GGGGTCCAGGAATCTGGGGGAGG 0: 1
1: 0
2: 12
3: 169
4: 679
1080635273_1080635288 24 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635288 11:34118302-34118324 TGTGCTGGGGTCCAGGAATCTGG 0: 1
1: 0
2: 3
3: 44
4: 308
1080635273_1080635284 10 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635284 11:34118288-34118310 GACTCCGGTGAGTCTGTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 88
1080635273_1080635283 9 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635283 11:34118287-34118309 AGACTCCGGTGAGTCTGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1080635273_1080635290 26 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635290 11:34118304-34118326 TGCTGGGGTCCAGGAATCTGGGG 0: 1
1: 0
2: 10
3: 128
4: 1348
1080635273_1080635289 25 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635289 11:34118303-34118325 GTGCTGGGGTCCAGGAATCTGGG 0: 1
1: 0
2: 5
3: 37
4: 331
1080635273_1080635276 -5 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635276 11:34118273-34118295 GGCCCTGCCTCCCCAGACTCCGG 0: 1
1: 0
2: 3
3: 55
4: 533
1080635273_1080635285 11 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635285 11:34118289-34118311 ACTCCGGTGAGTCTGTGCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
1080635273_1080635287 17 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635287 11:34118295-34118317 GTGAGTCTGTGCTGGGGTCCAGG 0: 1
1: 0
2: 5
3: 40
4: 424
1080635273_1080635291 27 Left 1080635273 11:34118255-34118277 CCACGTTGCCACCATGGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1080635291 11:34118305-34118327 GCTGGGGTCCAGGAATCTGGGGG 0: 1
1: 0
2: 2
3: 40
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080635273 Original CRISPR GGGCCTCCATGGTGGCAACG TGG (reversed) Exonic
900245685 1:1635043-1635065 GGGCCTCCACTCTGGCAAGGTGG - Intronic
900256915 1:1702200-1702222 GGGCCTCCACTCTGGCAAGGTGG - Intronic
900610287 1:3541811-3541833 GGGGCTCCCTGGGGGCACCGTGG + Intronic
900986226 1:6074131-6074153 GAGCCTCCATGGGGGCAGCTAGG - Intronic
902735154 1:18395723-18395745 GGGCTTCCATGGTGGGAAAGAGG + Intergenic
903063558 1:20686009-20686031 GGGCCTCCATGTGGGGGACGGGG - Intronic
903367998 1:22816675-22816697 GGGGCTACCTGGTGGCAAGGAGG - Intronic
903646432 1:24898882-24898904 AGGCCTCCTTGCTGGCAAGGTGG + Intergenic
903649422 1:24913845-24913867 GGGCCTGCATGGAGGCAAGGGGG - Intronic
903885613 1:26539397-26539419 GGGCCTTCCAGGTGGCAAAGAGG + Intronic
904677837 1:32209186-32209208 AGGCCTCCATGGTGGGGAAGCGG - Exonic
905137144 1:35808404-35808426 GCGCCTCCATGGCGGCGGCGGGG - Exonic
918207631 1:182323698-182323720 GCTCCTCCCTGGTGGCAACCAGG - Intergenic
919012564 1:191983790-191983812 AGGCATCCAGGGTGGAAACGTGG + Intergenic
924627354 1:245706717-245706739 GGGCCTCCATGCTGCCGCCGGGG + Intronic
1065156870 10:22879232-22879254 GGGCATCCATGTTGGAAAAGAGG - Intergenic
1066291263 10:34016382-34016404 GGGCATCTATGGTGGGAACTGGG + Intergenic
1069092821 10:64223116-64223138 AGGCATCCATGGTGGGAATGTGG - Intergenic
1074424548 10:113339275-113339297 AGGCCTCCAACGTGGGAACGCGG - Intergenic
1075900344 10:126038044-126038066 GGGCTTCCATGGGGGCACCGTGG + Intronic
1076650380 10:131982710-131982732 GGGCCTCCGGGGTGCAAACGCGG + Intergenic
1077144613 11:1039370-1039392 GGGGCTCCATCGTGGCACCATGG + Intergenic
1077344318 11:2039334-2039356 GGGCTTCCCTGCTGGCCACGAGG + Intergenic
1077490593 11:2859194-2859216 GGGCCTCCATGGAGCCCACGTGG - Intergenic
1078484401 11:11708095-11708117 GGGCTTCCATGATGGCAGTGTGG + Intergenic
1080425084 11:32147542-32147564 GGGCCAACATGGTGGCACCATGG - Intergenic
1080635273 11:34118255-34118277 GGGCCTCCATGGTGGCAACGTGG - Exonic
1084265324 11:68002724-68002746 AGGCCTCCAAGGAGGCCACGAGG + Intronic
1084518276 11:69648015-69648037 CGCCCTCCATGGTGGCAGCGGGG + Exonic
1084688508 11:70711262-70711284 GGGTCACCCGGGTGGCAACGTGG + Intronic
1202827304 11_KI270721v1_random:94523-94545 GGGCTTCCCTGCTGGCCACGAGG + Intergenic
1094311291 12:29086710-29086732 GGGCATGCATGGTGGCCACCAGG - Intergenic
1097046394 12:56190045-56190067 GGGCCGCCAGGGTGGCGACTAGG - Intergenic
1097394943 12:59061835-59061857 GTGCCTCCAGGGTGGCAAGCAGG - Intergenic
1110899537 13:80803269-80803291 GGCCCTCCATGGTGCCAAGCAGG + Intergenic
1112681070 13:101765495-101765517 TGGCCTCCATGGAGGCAAGCAGG + Intronic
1113533043 13:111043143-111043165 GGGCCTCCAAGGAGGCACAGTGG + Intergenic
1114548556 14:23520387-23520409 GGGCCTCCAGGGGGGCAGCAGGG + Intergenic
1120858652 14:89234860-89234882 GGGCAGCCCTGCTGGCAACGAGG - Intronic
1122100634 14:99406883-99406905 GGGCCTCCCTGGTGGCAGTGAGG + Intronic
1202848383 14_GL000225v1_random:843-865 GGAGCTCCATGGTGGCAGCTGGG + Intergenic
1202848778 14_GL000225v1_random:2379-2401 GGCACTCCATGGTGGCAGCTGGG - Intergenic
1202855057 14_GL000225v1_random:44587-44609 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857480 14_GL000225v1_random:59877-59899 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG + Intergenic
1202859202 14_GL000225v1_random:71420-71442 GGAGCTCCATGGTGGCAGCTGGG + Intergenic
1202864361 14_GL000225v1_random:105306-105328 GGAGCTCCATGGTGGCAGCTGGG - Intergenic
1124633858 15:31352871-31352893 GGACCTCCAGGGTGGCTACTTGG + Intronic
1124925465 15:34066218-34066240 GGGCCTCCGTGATGCCAACTGGG + Exonic
1125724349 15:41860734-41860756 GGGGCTCCATGGGGGCCAAGGGG + Exonic
1128501364 15:68229570-68229592 GGGCAGCCATGGAGGCGACGCGG - Exonic
1128995639 15:72292436-72292458 GGGCCTCCATAGTCCCAAGGGGG + Intronic
1129170053 15:73802069-73802091 GGCCTTCCATGGTGGCAGCAGGG - Intergenic
1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG + Intronic
1141412447 16:83844919-83844941 GGGCCTCCATCGTGTGAACTGGG + Intergenic
1142755856 17:2015964-2015986 GGGCGGCCAGGGTGGCACCGAGG + Intronic
1150939245 17:69672110-69672132 GAGCCTACATGGTGTCAACGTGG + Intergenic
1151853533 17:76706181-76706203 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853560 17:76706328-76706350 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1155083117 18:22430077-22430099 GGGCCTCCTTGGTGGGATGGAGG + Intergenic
1156375313 18:36509862-36509884 TTGCCTACATGGTGCCAACGAGG - Intronic
1156462019 18:37326512-37326534 GGGCCTCCATGGGGACACTGAGG - Intronic
1158447476 18:57533711-57533733 GGGCCTACATGCTGGCACAGCGG - Intergenic
1161397961 19:4054629-4054651 CGGCCTCCTTGGTGGCATCCAGG + Exonic
1163490391 19:17614398-17614420 TGTCCTCCATGGTGCCAATGGGG + Intronic
1163634298 19:18431265-18431287 GGGGCTCCATGGAGGCAGAGGGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167938053 19:52923443-52923465 AGGCCTCCGTGGAGCCAACGAGG + Intergenic
1168351714 19:55679896-55679918 GAGCCTCTCTGGAGGCAACGAGG + Intronic
926321738 2:11753141-11753163 GAGCTTCCAGGGTGGCAAAGTGG - Intronic
933773203 2:85756415-85756437 GGGCTTCCCTAGTGGCAAGGTGG - Intronic
937296451 2:120812524-120812546 GGTCCCCCATGGTGGCAGCACGG - Intronic
938387446 2:130877052-130877074 AGCCCTCCATGGTGGCGATGGGG + Intronic
938556015 2:132424950-132424972 GGGCCTCCGTGCTGGGAAAGTGG - Intronic
942795566 2:179814613-179814635 GGCCCTCAATGGTGGCGACCTGG + Intronic
948991857 2:241559471-241559493 GCACCTCCATGGCGGCGACGCGG - Exonic
1173867847 20:46323890-46323912 GGGTCTCCATGGAGTCAAGGAGG + Intergenic
1180874176 22:19167107-19167129 GCGCCGGCAGGGTGGCAACGAGG - Intergenic
1183987286 22:41576521-41576543 GGGCCTCCTGGGTGGCAGGGGGG + Exonic
1185349250 22:50326109-50326131 GGGCCTCCCTGGAGGAAAGGAGG + Intronic
949218577 3:1601223-1601245 GGCCCTCCATGGTCGGAAGGTGG + Intergenic
949473410 3:4419655-4419677 GGGCTTCCACAGTGGCAACCTGG + Intronic
950536612 3:13582541-13582563 CGGCCTCCATGCTGGGAAAGTGG + Intronic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
961678789 3:128584673-128584695 AGGCAGCCCTGGTGGCAACGGGG + Intergenic
968046946 3:195629928-195629950 GGGGCTCCATGGAGGCCATGGGG - Intergenic
968307707 3:197660116-197660138 GGGGCTCCATGGAGGCCATGGGG + Intergenic
973542956 4:51952946-51952968 GGAACTGCAAGGTGGCAACGAGG - Intergenic
981670317 4:147279352-147279374 GGGTATCAATAGTGGCAACGAGG - Intergenic
983079820 4:163371450-163371472 GGGTCTCCTTGGTGGCAAGGAGG - Intergenic
985107667 4:186514826-186514848 GGGCAGCCGTGGTGGCAAGGTGG + Intronic
985629837 5:1008695-1008717 GGGGCTCCAGGCTGGGAACGGGG + Intergenic
985744668 5:1639215-1639237 GGGGCTCCATGGAGGCCATGGGG + Intergenic
985997791 5:3606402-3606424 GGGCCTGAATGGTGACCACGCGG + Intergenic
986619697 5:9659515-9659537 GGCCCACGCTGGTGGCAACGAGG + Intronic
987253756 5:16127363-16127385 GGGCCTCCAAGGTCACCACGAGG - Intronic
996841411 5:127851038-127851060 AAGCCTCCATGGTGGCACCAGGG - Intergenic
998618415 5:143767423-143767445 TGTCATCCATGGTGGCAAAGTGG + Intergenic
999702993 5:154245188-154245210 GAGCCACCATGGTGGCAGTGAGG + Intronic
1001425475 5:171619454-171619476 GGGTCTCCAGGGTGGCGTCGTGG - Intergenic
1001560399 5:172665445-172665467 GGGCCTCCAGGGCAGCAAGGAGG - Intronic
1003195059 6:3906849-3906871 TGGCCTCCATGGTGGCACGTGGG - Intergenic
1006942591 6:37762874-37762896 GGGCCTCCCTGGCTGCAACCTGG + Intergenic
1014164483 6:118208164-118208186 GGGCCTGCATGCAGGCAGCGGGG - Intronic
1017701995 6:157083430-157083452 GGGCCTCCATGGGAGCCATGGGG + Intronic
1024547151 7:50531699-50531721 AGGCCACCCTGGTGGCATCGGGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1039892333 8:41694021-41694043 GGGGCTCCACGGTGACAATGGGG + Exonic
1042086395 8:65113936-65113958 GGGCCACTATGGTAGCAACCGGG + Intergenic
1042930491 8:74008553-74008575 GGGCCTACATGAAGGCAGCGCGG + Intronic
1050075399 9:1857662-1857684 GGGCATCTGTGGTGGCAAAGTGG - Intergenic
1051108159 9:13604046-13604068 GGGAGTCCATGGTGGGAATGTGG + Intergenic
1056813355 9:89781642-89781664 GGGCCTGGCTGGTGGCAAGGAGG - Intergenic
1057030182 9:91769371-91769393 TGGCCTCCTTGGTGGCAGCCTGG + Intronic
1061409979 9:130415093-130415115 GGGTGTCCATGGAGGCCACGTGG + Intronic
1061753777 9:132798823-132798845 GGGGATCCATGGTGGCAAGTGGG + Intronic
1203768159 EBV:37168-37190 TGGCCACCATGGTGGCCCCGAGG - Intergenic
1203739962 Un_GL000216v2:170711-170733 GGCACTCCATGGTGGCAGCTGGG + Intergenic