ID: 1080635619

View in Genome Browser
Species Human (GRCh38)
Location 11:34120955-34120977
Sequence CAGAGGAAGCAGCATGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 1, 2: 37, 3: 135, 4: 674}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080635614_1080635619 9 Left 1080635614 11:34120923-34120945 CCCTGTGGCTCTTGGGGAGCCAC 0: 1
1: 0
2: 3
3: 25
4: 192
Right 1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG 0: 1
1: 1
2: 37
3: 135
4: 674
1080635618_1080635619 -10 Left 1080635618 11:34120942-34120964 CCACTGCTTCAGGCAGAGGAAGC 0: 1
1: 0
2: 2
3: 19
4: 267
Right 1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG 0: 1
1: 1
2: 37
3: 135
4: 674
1080635615_1080635619 8 Left 1080635615 11:34120924-34120946 CCTGTGGCTCTTGGGGAGCCACT 0: 1
1: 0
2: 2
3: 24
4: 190
Right 1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG 0: 1
1: 1
2: 37
3: 135
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080635619 Original CRISPR CAGAGGAAGCAGCATGTGCA TGG Intronic
900025247 1:266781-266803 CAGAGGCTGTAGAATGTGCACGG + Intergenic
900028849 1:356163-356185 CAGAGGCTGTAGAATGTGCACGG + Intergenic
900392276 1:2438857-2438879 CAGGGGGCGCAGCGTGTGCAGGG + Intronic
900929322 1:5726358-5726380 CAGAGGCAGCTGCAGGAGCAAGG + Intergenic
900929435 1:5726926-5726948 CAGAGGCAGCTGCAGGAGCAAGG - Intergenic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
903219529 1:21861328-21861350 CAGAGGGAACAGCATAAGCAAGG + Intronic
903739086 1:25547870-25547892 TAGAGGGAACAGCAAGTGCAGGG + Intronic
904266712 1:29322523-29322545 GAGAGGGAGCAGCCTGTGCAGGG + Intronic
904419406 1:30381974-30381996 CAGAGGAGGAAGCATGGGCAGGG + Intergenic
904454890 1:30641606-30641628 CAGAGGAAACAGCATGTGTGAGG - Intergenic
904480239 1:30788771-30788793 CAGAGGGAACAGCATGTACAAGG + Intergenic
904616200 1:31751193-31751215 TAGAGGAAACAGCCTGTGCAAGG - Intronic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
904825012 1:33268673-33268695 GAGAGGATGCAGCCTGTGGAAGG + Intronic
905101154 1:35523169-35523191 TAGAGGAGGCAGCATGTCAAAGG - Intronic
905110562 1:35591481-35591503 TAGAGGTGGCAGCATGTGAACGG - Intronic
905515732 1:38560551-38560573 CAGAGGATGCTATATGTGCATGG + Intergenic
905851264 1:41276855-41276877 CAGAGGGAGCACCCTGTGCTTGG + Intergenic
905890707 1:41516750-41516772 CAGAGGGAGCAGCAGGTGTGGGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906731925 1:48089884-48089906 CTGAGGAAGTGGCCTGTGCAAGG - Intergenic
906741425 1:48189100-48189122 CAGAGGAAGCAAGCTGTGCAGGG + Intergenic
906786680 1:48622191-48622213 CAGGGGAAGCAGCATATGTGAGG - Intronic
907184320 1:52598197-52598219 TAGAGGAAGCAGCAAGTACAAGG - Intergenic
907393059 1:54171219-54171241 CAGAGGAAGCAGCGAGTGTAAGG + Intronic
907551481 1:55308703-55308725 TAAAGGGAGCAGCATGTGCAAGG - Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908060283 1:60340828-60340850 CAGAGGAAGCTGCACCAGCAAGG + Intergenic
908241695 1:62194220-62194242 CAGAGGAAACAGCCAGTGCAAGG + Intergenic
908393624 1:63705457-63705479 CTGAGGAAGCAGTATGAACAAGG - Intergenic
908463657 1:64370282-64370304 CAGAGGGAACAGCTAGTGCATGG + Intergenic
908642032 1:66234910-66234932 CAGCTAAAGCAGCATGTTCAGGG - Intronic
908979327 1:69935088-69935110 CAAAGAAAGCAGCATGGGTAGGG + Intronic
909220734 1:72957944-72957966 TAGAGGAAGTAGCATCTACAGGG + Intergenic
910436161 1:87208300-87208322 TAGAGGACACAGCGTGTGCAGGG - Intergenic
910845564 1:91601807-91601829 CTGAGGAAGCAGCAACGGCAGGG - Intergenic
912179057 1:107195733-107195755 CAAAGGAATCAGCAAGTGCAAGG - Intronic
912251198 1:108014212-108014234 CAGAGGAAACAGCATGTACAAGG - Intergenic
912617688 1:111121949-111121971 CAGAGGAAACAGTATGTGAGAGG + Intronic
912839585 1:113027253-113027275 CAGGCCAAGCAGCATGTCCAAGG - Intergenic
913167262 1:116199744-116199766 CAGAGGATGCAGTCAGTGCATGG + Intergenic
913234854 1:116770972-116770994 TAGAGGCAACAGCATGAGCAAGG + Intergenic
913968834 1:143398533-143398555 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914063213 1:144224132-144224154 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914115937 1:144742222-144742244 AAGAGGAAGCAGCAAGTGCAAGG + Intergenic
914425152 1:147569184-147569206 AAGAGGGAACAGAATGTGCAAGG + Intronic
915320869 1:155055867-155055889 CAGGGGGAGGAGGATGTGCAGGG - Intronic
915742889 1:158132813-158132835 TACAGAAAGCAGCAGGTGCATGG - Intergenic
915989596 1:160500552-160500574 CAAAGGCAGCTGGATGTGCAAGG - Intronic
916052990 1:161049095-161049117 GAGAGGCAGCAGGATGTGGAAGG - Exonic
916155332 1:161839783-161839805 CAGAGGAAACAGCCATTGCAGGG + Intronic
916589305 1:166175126-166175148 AAGAGGAATCAACATATGCAAGG - Intergenic
918238911 1:182604568-182604590 CAGAGGACGCCGCGTGTGGAAGG + Intergenic
918499331 1:185176426-185176448 CAGAGGGAGCTACATGAGCAGGG + Intronic
919540943 1:198844442-198844464 CAGAGGTAGAAGCATTTGCTGGG - Intergenic
919624611 1:199899204-199899226 CAGAGGAAACAGCATATGTTTGG - Intergenic
919711969 1:200738129-200738151 CAGAGGAACCACCCTGAGCAAGG + Intergenic
919756566 1:201069730-201069752 CAGAGGACCCTGCAGGTGCAGGG - Intronic
919866541 1:201787174-201787196 GAGAGGAAGCATCAGGTGGAGGG + Intronic
920194003 1:204213962-204213984 CAGAGGACGCAGCTGGTACATGG + Exonic
920244107 1:204575273-204575295 GCAAGGAAGCAGCATTTGCAAGG + Intergenic
920259393 1:204678674-204678696 CAGAGGGGACAGCAGGTGCAAGG - Intronic
921558912 1:216633273-216633295 CGGAGGAGACAGCATGAGCAAGG + Intronic
923247699 1:232148823-232148845 CAAAGGAAGCAGCATGTCTAGGG - Intergenic
923396264 1:233568060-233568082 CAGAGGCCCCAGCATGTGCCAGG - Intergenic
1063243129 10:4191951-4191973 CAGAGAAAGTAGCATGTTTAAGG + Intergenic
1063536717 10:6890952-6890974 CTGAGCAAGGAGCCTGTGCAGGG - Intergenic
1064044114 10:11995838-11995860 CAGAGGCAACAGTATGTGCAGGG - Intronic
1064319037 10:14284860-14284882 CAGAGGAAGAAGCATTTGAGTGG - Intronic
1065172241 10:23043062-23043084 CAAAGCAAGCAGCATGAGCCAGG + Intergenic
1065326843 10:24556928-24556950 CACAGGAAGCAGCTTGTGGCTGG - Intergenic
1065628305 10:27653475-27653497 CAGAGCATGCAGGATATGCAGGG - Intergenic
1065807025 10:29403450-29403472 CAGAGGAAGCTGGGAGTGCATGG + Intergenic
1066675701 10:37884788-37884810 CAGGGAAAGCATCAAGTGCAGGG + Intergenic
1067092216 10:43273656-43273678 CAGAGGGAGGGGCCTGTGCAAGG + Intergenic
1067969684 10:50955148-50955170 CAGAGAAAGAAGCTGGTGCATGG + Intergenic
1068253216 10:54470573-54470595 CATAGGAAGCTGCATGGGGATGG - Intronic
1068894236 10:62181751-62181773 AAGAGGAAACAGCAAGTGCAAGG + Intergenic
1068922686 10:62501306-62501328 CAGAGGGAAGAGCATGTGCAAGG - Intronic
1069021192 10:63490202-63490224 TAAAGGAAGCAGCATGTGCAAGG - Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069654770 10:70079625-70079647 GAGAGGTGGCAGCATCTGCAAGG + Intronic
1069701860 10:70432707-70432729 GGGAGGAAGAAGCCTGTGCAGGG - Exonic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070490524 10:76971627-76971649 CAGAGGAAGCAGGTGGTACAGGG - Intronic
1070673350 10:78393687-78393709 CTGAGGATGAAGAATGTGCAAGG + Intergenic
1071494142 10:86156199-86156221 CAGAGGAAGACGGATGTGCTGGG - Intronic
1071524719 10:86351845-86351867 CAGAGGACTTAGCATGTGCCTGG - Intronic
1073308182 10:102519641-102519663 CAGAAGCAGCAGCATGACCATGG - Intronic
1074158430 10:110817785-110817807 CAGAGGAAGCAGCATGCACAAGG + Intronic
1074324518 10:112436065-112436087 CAGAGGGAACAACATGTGCAAGG + Intronic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074895989 10:117778176-117778198 CAGAGGGAGGAGCAGGTACAAGG + Intergenic
1075092277 10:119450552-119450574 CCCTGGAAGCAGCATGTGGAAGG + Intronic
1075285719 10:121184210-121184232 CACAAGAAGCAGCATGCCCAAGG + Intergenic
1075715147 10:124551430-124551452 CAGAGCAGGCAGCGTGAGCAAGG - Intronic
1075836682 10:125459698-125459720 CAGAGAAAGAAACATGTTCAAGG + Intergenic
1075933797 10:126322628-126322650 CTGAGGATCCAGCATGTGTAGGG + Intronic
1076049094 10:127318487-127318509 GAGAGGCAGCAGCATGTGCAAGG + Intronic
1076100443 10:127773668-127773690 CAGAGTGAGAAGCATGTGTATGG + Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1077421757 11:2453776-2453798 CAGGAGAAGCTGCGTGTGCAGGG + Intronic
1077883983 11:6372273-6372295 CAGAAGGAACAACATGTGCAAGG - Intergenic
1078088560 11:8249356-8249378 CAGAGAAAGCAGCATATGATGGG - Intronic
1078413943 11:11149999-11150021 CAGAGGGAACTGCATATGCAAGG - Intergenic
1078460172 11:11509090-11509112 CAGAGGATTCAGAATGGGCAAGG - Intronic
1078508323 11:11967984-11968006 CAGGGGAAGCAACAGGTGTAGGG + Intronic
1078546337 11:12249672-12249694 CAGTGAGAGCAGAATGTGCAGGG - Intronic
1078758892 11:14235913-14235935 CACAGGGAACAGCAAGTGCAAGG + Intronic
1078794663 11:14580332-14580354 CAGATGGAACAGCATGTTCAAGG - Intronic
1079148785 11:17878797-17878819 TAGAGGAAGAGGCATGTGCAAGG - Intronic
1079341406 11:19614501-19614523 CAGAGGATGCTATATGTGCAGGG - Intronic
1079787077 11:24686850-24686872 TCGGGGAAGCAGCATGAGCAGGG - Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080665047 11:34328438-34328460 CAGAGGAAGCAGCAGAGGCTTGG - Intronic
1080922823 11:36725924-36725946 CAGACAAGACAGCATGTGCAGGG + Intergenic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1081159037 11:39731478-39731500 CAGGGGAAGCATCATGGGAAAGG - Intergenic
1081723162 11:45304728-45304750 CAGAGGTACCCGCAGGTGCAGGG + Intergenic
1081971380 11:47201219-47201241 CAGAGGCAGCAGGAAATGCATGG + Intergenic
1082812006 11:57483966-57483988 CAGAGGCACAAGCAGGTGCAGGG + Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082893486 11:58164868-58164890 CAGAGGGAACAGCAAATGCAAGG - Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083714936 11:64569732-64569754 GAGAGGAGGCAGCAGGGGCAGGG - Exonic
1083831082 11:65233990-65234012 CTGAGCAGGCAGCATGTCCAAGG + Intergenic
1084420820 11:69059652-69059674 CACCTGAAGCAGCATTTGCAGGG + Intronic
1084545242 11:69812120-69812142 AGGTGGAAGCAGCAGGTGCAAGG + Intronic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1084900149 11:72303503-72303525 AAGGGGAGGCAGCATGTCCAAGG - Intronic
1085054317 11:73395015-73395037 CAGAGAAGGCAGCACGTGCCCGG - Intronic
1085515362 11:77108395-77108417 CAGAGGGAGCCACATGTGCGTGG + Intronic
1085777408 11:79379146-79379168 AATAGGTAGCAGCATATGCAAGG + Intronic
1085829627 11:79885500-79885522 CAGAGGAGGTCGCCTGTGCACGG + Intergenic
1085932555 11:81101933-81101955 CAGAGGAAGTAGCAGATGGAAGG - Intergenic
1086051936 11:82602651-82602673 CTTAGGAACCAGCATGTGCAAGG - Intergenic
1086308485 11:85508362-85508384 CAGAGGGAATAGCAAGTGCAAGG - Intronic
1086558656 11:88141778-88141800 CAGAGGAAACAGCACGTGAAAGG - Intronic
1087543566 11:99552625-99552647 CAGAGGACACAGTATGTGCTTGG + Intronic
1087717175 11:101621928-101621950 CAAAGAGAGGAGCATGTGCAAGG + Intronic
1088134462 11:106537450-106537472 CAGAGGGAACAGTATGAGCAGGG - Intergenic
1088710044 11:112499681-112499703 CAGAGCAATCAGCCAGTGCAGGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089224046 11:116900633-116900655 GAGAGGAAATAGCATGTGGAAGG - Intronic
1089560631 11:119341456-119341478 CAAAGGAAGGAGCATCAGCAGGG - Exonic
1089747590 11:120628072-120628094 GAGAGGAGGCAGCCTGTGCCGGG + Intronic
1090043263 11:123309377-123309399 CAGAGGAAGAAGCATTTGAGTGG + Intergenic
1090257744 11:125297736-125297758 CAGAGGAAACAGCATTTTCAAGG - Intronic
1091239691 11:134044094-134044116 CAGAGGGAGCTGCATGGGGAAGG - Intergenic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1091748339 12:3007196-3007218 CAGAGGACTCAGCCTCTGCAAGG - Intronic
1091989093 12:4940173-4940195 CAGAGGGCACAGCAAGTGCAAGG + Intergenic
1092522112 12:9285832-9285854 CAAGGGGAGCAGCAAGTGCAAGG + Intergenic
1092534579 12:9376296-9376318 CAGATTAAGCAGCGTGTGCTGGG + Intergenic
1092545170 12:9446024-9446046 CAAGGGGAGCAGCAAGTGCAAGG - Intergenic
1093158836 12:15720785-15720807 CAGAGGGAGCAACATGCCCAGGG - Intronic
1093312993 12:17615182-17615204 CAGATGCAGCAGCAATTGCATGG + Intergenic
1093414002 12:18899398-18899420 CAAAGTAAACAGCATTTGCAAGG - Intergenic
1093775489 12:23068872-23068894 TAGAGTAAGGAGCATGTGCCAGG + Intergenic
1094146052 12:27229513-27229535 AAGAGGAAACAGCAAATGCAAGG - Intergenic
1094507777 12:31076025-31076047 CAAGGGGAGCAGCAAGTGCAAGG + Intronic
1094701235 12:32872621-32872643 CAGGGGAACCAGCCTGGGCAGGG - Intronic
1095964306 12:47856867-47856889 TAGAGGAAACAGCATGGGCCCGG + Intronic
1096182709 12:49559410-49559432 CAGAGGAAGCAGCCTAAGAAGGG + Intronic
1096186636 12:49585894-49585916 CTGAGGTAGCAGCCTGGGCAGGG + Intronic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097519465 12:60648704-60648726 CAGAGGACGCAGCTGTTGCATGG - Intergenic
1098190671 12:67945191-67945213 CTGAGGAAGGAGCATGGGAAGGG + Intergenic
1098270014 12:68761044-68761066 CAGAGGCAACAGCAGGTGCGAGG + Intronic
1099085852 12:78244951-78244973 CAAAAGCAACAGCATGTGCATGG - Intergenic
1099396388 12:82146092-82146114 TAGAGAAGACAGCATGTGCAGGG - Intergenic
1100004247 12:89874807-89874829 CACAGCAAGCATCAAGTGCATGG - Intergenic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101476167 12:105050751-105050773 AAGAGGCAAGAGCATGTGCAGGG + Intronic
1101991336 12:109487814-109487836 GAGGGGAAGCAGCTTGTTCAAGG - Intronic
1102206698 12:111095918-111095940 GAGAGCAACCACCATGTGCAGGG - Intronic
1102209949 12:111119222-111119244 TAAAGGAAGATGCATGTGCAGGG + Intronic
1102682887 12:114702546-114702568 GAGAGCAAGAAGCAAGTGCAGGG + Intergenic
1102730868 12:115108217-115108239 CAGAGGGAAAAGCAAGTGCAAGG - Intergenic
1103405961 12:120675451-120675473 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1104091556 12:125521857-125521879 CTTAGGAAGCAGCATCTTCAGGG + Intronic
1104647608 12:130508462-130508484 CAATGGAATCAGCAGGTGCAGGG - Intronic
1104692150 12:130834427-130834449 CAAAGGGAGCAGCACCTGCAAGG + Intronic
1104715967 12:131016441-131016463 CAGAGGGGACAGCCTGTGCAGGG - Intronic
1104848974 12:131862114-131862136 CAGAGGGAACAGCTAGTGCAAGG + Intergenic
1106230284 13:27816063-27816085 CAGAGGGAACAACATGTGCGAGG - Intergenic
1108850787 13:54727049-54727071 CAGAGAAGAAAGCATGTGCAGGG - Intergenic
1109247367 13:59971826-59971848 CAGAGGGACCAGCATGTACAAGG - Intronic
1109332386 13:60945539-60945561 CAGAGGGAGCAGCTAGTGCAAGG + Intergenic
1110164890 13:72429484-72429506 CTGAGGAAACAGCAAGTGCTTGG + Intergenic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1110616842 13:77551138-77551160 GAGAGGATGCAACATGTCCAAGG - Intronic
1111376054 13:87380137-87380159 CAGAGTAAGCTGCACGTGGAGGG - Intergenic
1112475640 13:99729039-99729061 CAGAGAAAGCAGAATGGCCAGGG + Intronic
1113309587 13:109118039-109118061 CAGAGAAACTAGCATGTGAAAGG - Intronic
1114429019 14:22644674-22644696 CAGAGGAAGAAGCAGGTTGATGG - Intergenic
1114483753 14:23050845-23050867 CTGAGGATGCAGCATGGGCAGGG + Intronic
1114597363 14:23925112-23925134 CAGAGGCAGCAGGAGGTGCTGGG - Intergenic
1115921492 14:38379244-38379266 CAGAGGAAACAGCAAGTGAATGG + Intergenic
1116570016 14:46504273-46504295 GAGAGAAATCAGCATGTTCATGG - Intergenic
1116996774 14:51332989-51333011 CAGAGGAGGCAGCAGGGCCAGGG - Intergenic
1117890852 14:60420428-60420450 CAGTGGCAGCAGCATGTGTTTGG + Intronic
1118235936 14:64005033-64005055 CAGAGGCAGCAGTAGGTACAAGG + Intronic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118838514 14:69493942-69493964 AGGGGGAAGCAGCATATGCAGGG + Intronic
1119045480 14:71314991-71315013 CAGAGGAAAGAGCAAATGCAAGG + Intergenic
1119558302 14:75570025-75570047 AAGAGGGAACAGAATGTGCAAGG - Intergenic
1119906128 14:78303738-78303760 AAGAGGGAGAAGCATGTTCAAGG - Intronic
1120094509 14:80373797-80373819 CAGAGGCATCTGCAAGTGCAAGG + Intronic
1120132254 14:80821941-80821963 AAGAGAAAGGAGCTTGTGCAGGG + Intronic
1120853963 14:89196779-89196801 CAGAGGAAGCGGAATGAACATGG - Intronic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121189439 14:92012655-92012677 CAGAGAAAGCAGAAAATGCAAGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121585206 14:95058595-95058617 CAGAGGAAGCTGCATGTCAAAGG + Intergenic
1122179944 14:99947506-99947528 CAGAGAAGGCTGCATGTGGAAGG - Intergenic
1122403424 14:101481300-101481322 CGGAGGATGCAGCCTGGGCAAGG - Intergenic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1122604143 14:102937384-102937406 CAGAACCAGCAACATGTGCAAGG + Intronic
1123805072 15:23862242-23862264 CAGAGGAACCAGAATGTGCTGGG - Intergenic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1126244295 15:46486139-46486161 GAGAGGAAGCAGGATGTGCAAGG - Intergenic
1126475221 15:49058792-49058814 CAGTGGAAGCAGCAAGGCCAAGG - Intergenic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127650957 15:61006600-61006622 CAGAGGAAGGAGCAACAGCATGG - Intronic
1127699128 15:61479990-61480012 CAGAGGAAATAGCAAGTGCAAGG + Intergenic
1129153120 15:73701567-73701589 TAGAGGAAACAGCAGGTGGAAGG - Intronic
1129322156 15:74781501-74781523 CAGAGGGAACAGCATGCACAAGG - Intergenic
1129384578 15:75188866-75188888 CAGAAGAAACATCATGGGCAAGG + Intergenic
1129452693 15:75659668-75659690 CAGAGCAGGAAGCATGAGCAGGG - Exonic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129974726 15:79812733-79812755 CAGATGACTTAGCATGTGCAAGG + Intergenic
1130024119 15:80256447-80256469 CAGAGGCAGCAGGAGGTGCATGG - Intergenic
1130064922 15:80595330-80595352 CTGAGCAAGCAGCATCTGCGAGG - Exonic
1130172946 15:81535582-81535604 CACAGGAAGCAGTATCTGAAGGG + Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130758198 15:86789059-86789081 TAGAGGAAATAACATGTGCAAGG + Intronic
1131087477 15:89589019-89589041 CAGGGGAAGCAGTGTGTTCAGGG + Intronic
1131102725 15:89705941-89705963 CAGAAGGAACAGCATGGGCAAGG - Intronic
1131140982 15:89977016-89977038 CAGCGGATGCTGCATGTGGAAGG + Intergenic
1131304437 15:91229108-91229130 CACAGAGAGCAGCCTGTGCACGG - Intronic
1131391325 15:92051278-92051300 CAGAGGCAACAGCATGTGTGAGG + Intronic
1131856561 15:96603305-96603327 CTGAGCAAGCAGCACATGCAAGG + Intergenic
1132734435 16:1378558-1378580 CAGAGTGCGCAGCATGTGGAGGG + Intronic
1132761617 16:1511217-1511239 CAGGGGCAGCAGCACGTGCCTGG - Intronic
1132993255 16:2808351-2808373 CAGAAGGAACAGCATGTGCCAGG + Intergenic
1133357418 16:5146910-5146932 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1133546711 16:6814676-6814698 CACAGGGAGCAGCATGTGGAAGG + Intronic
1133848729 16:9481657-9481679 CAGAGGAGGCAGCATTTGAACGG + Intergenic
1134179229 16:12034225-12034247 TGGAGGAAGCTGCATGTGCCAGG + Intronic
1134254456 16:12600262-12600284 CAGAGGCGGCAGCATGGCCAGGG + Intergenic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1135054394 16:19218891-19218913 CAGAGGGAACAACATGTGCAAGG - Intronic
1135109711 16:19681229-19681251 AGGAGGCAGCAGCATATGCAGGG + Intronic
1135305964 16:21368010-21368032 TGGAGGAAGCTGCATGTGCCAGG + Intergenic
1135651131 16:24207855-24207877 CAGAGGAGGCAGCCTGTGCAAGG + Intronic
1135788469 16:25371972-25371994 CAGATGATGCATCAAGTGCAGGG - Intergenic
1135991274 16:27220295-27220317 CCCAGGGAGCAGCATGTGGAAGG + Intronic
1136073170 16:27801088-27801110 CAGAGAGAACAGCAAGTGCAAGG + Intronic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1136239624 16:28936252-28936274 CAGAGGAAACAGTAAGTGCAAGG - Intronic
1136302704 16:29347162-29347184 TGGAGGAAGCTGCATGTGCCAGG + Intergenic
1136521964 16:30802607-30802629 CAGAGCCAGCAGCATGGCCAAGG + Intergenic
1137322334 16:47397716-47397738 TAGAGGAAGCAGCAAAGGCAAGG + Intronic
1137398864 16:48136771-48136793 CAAAGGAAACAGCAATTGCAAGG + Intronic
1137732397 16:50698325-50698347 CAGTGGCAGCAGTCTGTGCACGG + Intronic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1138194205 16:55040529-55040551 CAGAGGAAGGACCATTTGCATGG - Intergenic
1138240023 16:55419895-55419917 CACCAGAAGCAGCAAGTGCAAGG - Intronic
1138369761 16:56517408-56517430 CAGAGGGATCTGCAGGTGCAAGG - Intronic
1138374001 16:56550033-56550055 CAGAGGGAACAGTATATGCAAGG - Intergenic
1138688491 16:58747073-58747095 CAGAGGCAGCAGCCTGTCCTGGG + Intergenic
1138959850 16:62016027-62016049 TAGAGGAAATAGCATGTTCAAGG - Intronic
1139002093 16:62524443-62524465 CAGAGGGAGTTGCATGAGCATGG + Intergenic
1139220718 16:65178841-65178863 GACAGGAGACAGCATGTGCAGGG + Intergenic
1139419711 16:66842993-66843015 CAGAGGACGCACCAGGTGGAGGG + Intronic
1139447777 16:67008774-67008796 CAGAGCAAACAGTATGTGCCAGG - Intronic
1139490982 16:67285901-67285923 CAGAGGAAAGAGCAAGTACAAGG + Intronic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1140350464 16:74257579-74257601 CAGAGACAACAGCATGAGCAAGG + Intergenic
1140738054 16:77916267-77916289 TAGAGGAGGCAGCATTTCCAAGG - Intronic
1141077555 16:81021351-81021373 CAGTGGTAGCAGCAAGTGCCAGG - Intronic
1141552053 16:84812829-84812851 CAGAGGAAGCATGCTGTTCAGGG + Intergenic
1141599595 16:85117441-85117463 CAGAGGCAGCGGCAGATGCAGGG - Intergenic
1141743592 16:85910941-85910963 CTGAGGAAGCGGCATGAGAAGGG + Intronic
1142132329 16:88436745-88436767 CAGAGGAGGCTGCAGGGGCAGGG + Exonic
1142863113 17:2775527-2775549 CAGGGGGAGCAGCAAGTGCAAGG + Intergenic
1142927904 17:3257246-3257268 GAGAGGAAACAGCACCTGCAAGG - Intergenic
1142994048 17:3750635-3750657 CAGAGGAAGTGGCATTTGGATGG + Intronic
1143555661 17:7658244-7658266 CAGAGGAGGTAGCATTTGAACGG + Intergenic
1143885201 17:10060061-10060083 GACCGGAAGGAGCATGTGCAGGG - Intronic
1143899360 17:10162153-10162175 CAGAGGGACCAGCATGTGCCTGG - Intronic
1144419050 17:15079260-15079282 TAGAGGAAACAGGATGTGCAAGG + Intergenic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1146254843 17:31385791-31385813 CAGAGGGAACAGCATATGCAAGG + Intergenic
1146326718 17:31892714-31892736 CAGAGGAAGCAAGACATGCATGG + Intronic
1147552600 17:41454859-41454881 CAGAGGAAACAGAATGTGCTAGG - Intergenic
1147575037 17:41594091-41594113 CAGGGGAAGGAACATGTCCAAGG + Intergenic
1147914495 17:43878457-43878479 CAGTGGAAGCTGGATGGGCAGGG + Intronic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148805376 17:50261217-50261239 CAGAGGGAGCAGCATTTGCAAGG + Intergenic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1149189924 17:54049506-54049528 AAGAGACAGCAGCATGTTCAGGG + Intergenic
1149370424 17:55988693-55988715 TAGAGGAAAGAGTATGTGCAGGG + Intergenic
1150611853 17:66739687-66739709 CAGAGGCAGAAGCAAGTCCAGGG + Intronic
1151823127 17:76507902-76507924 CAGAGCTGGCAGCCTGTGCAGGG - Intergenic
1152019352 17:77772391-77772413 GAAAGGAACCAGCATGTGCTGGG - Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152287768 17:79422492-79422514 CAGAGGAGGCAGCCTGGGCCGGG - Intronic
1152602317 17:81270598-81270620 CAGAGGTGGCAGCAGGTCCATGG + Intronic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1152885380 17:82846243-82846265 CAGAGGACGCAGCGCGTGGAGGG - Intronic
1152950909 17:83230394-83230416 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1155224091 18:23713281-23713303 TAGAGGAACCAGCACGAGCAAGG - Intronic
1156218877 18:35030753-35030775 CAGAGAAACCAGAATGTGCAGGG - Intronic
1157034496 18:43954643-43954665 CAGGGGAAGGAGTATGTACAAGG - Intergenic
1157190706 18:45579079-45579101 CAGAGAAAGCAGAAGCTGCAAGG + Intronic
1157313867 18:46572456-46572478 CAGAGGAAGCAACATATCCTGGG + Intronic
1157644444 18:49252737-49252759 CAGAGGAAACAGCCAGTGGAGGG + Intronic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158209090 18:55026181-55026203 TAGAAGAACCAGCATGTGCAAGG + Intergenic
1158537490 18:58321353-58321375 CAGAGGGACCTGCCTGTGCATGG + Intronic
1158965262 18:62616863-62616885 CAGAGTAAGCAGCAAGGGCTAGG + Intergenic
1159160253 18:64635036-64635058 GAGTGGAAGCAGCAGGTGTATGG + Intergenic
1159299689 18:66547220-66547242 CAGAGACAACAGCATCTGCAGGG + Intronic
1160571259 18:79819114-79819136 CAGAGGAGGCAGCAGCTCCACGG + Intergenic
1161436807 19:4268466-4268488 CAGAGGTGACAGCATGTGAATGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162858994 19:13491434-13491456 AAGAGGAAGCACCATGTCCCAGG - Intronic
1163126472 19:15246843-15246865 GAGAGAAGGCGGCATGTGCACGG + Intronic
1163221712 19:15926299-15926321 CATAGCAAGCAGCATGTTCTTGG - Intronic
1163552404 19:17972957-17972979 CAGAGGGCACAGCCTGTGCAAGG + Intronic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1164673801 19:30088801-30088823 CAGAGGAAGCACCCTGTGAATGG + Intergenic
1164770096 19:30801775-30801797 GAGAGGCACCAGCAAGTGCAGGG - Intergenic
1164886336 19:31781829-31781851 CAGGGAGGGCAGCATGTGCAGGG + Intergenic
1164966021 19:32484729-32484751 AAGAGGAAGCAGAACTTGCATGG - Exonic
1165137883 19:33681831-33681853 CAGTGGAAGCAGCTTGAACAAGG - Intronic
1165454923 19:35904820-35904842 CAGAGGAAACAGCACACGCAGGG - Intronic
1165695895 19:37900788-37900810 CAGAATGAGCAGCAAGTGCAGGG - Intronic
1166074774 19:40407594-40407616 CAGAAGAGGCAGCATATGCCAGG - Intronic
1166345160 19:42161202-42161224 CAGAGAAAGAACCAGGTGCAAGG + Intronic
1166822577 19:45589574-45589596 CAGAGGGAACTGCAGGTGCAAGG - Intronic
1167120232 19:47512355-47512377 CAGAGGAAGCAGCGTGAACCAGG - Intronic
1167141009 19:47650819-47650841 GAGAGGAAGGAGCATGTGTGAGG + Intronic
1167246434 19:48375892-48375914 CAGAGGAAGCGGCACCTGGAAGG - Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167736227 19:51296085-51296107 CAGAGCAAGCAGCATTTCTAGGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168253461 19:55154537-55154559 CAGAGGGAACAGCACATGCAAGG - Intronic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
1202702625 1_KI270712v1_random:176003-176025 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
924982303 2:235347-235369 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982317 2:235388-235410 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982330 2:235426-235448 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982351 2:235489-235511 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982364 2:235527-235549 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982385 2:235590-235612 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982412 2:235672-235694 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982444 2:235776-235798 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982451 2:235795-235817 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982458 2:235814-235836 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982484 2:235899-235921 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982510 2:235984-236006 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982517 2:236003-236025 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982537 2:236063-236085 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982564 2:236145-236167 CAGGGGAGGCAGCATGGGCCAGG + Intronic
924982598 2:236252-236274 CAGGGGAGGCAGCATGGGCCAGG + Intronic
925221632 2:2146456-2146478 CGGAGGATGGAGCATCTGCAGGG + Intronic
925277724 2:2662273-2662295 CAGATGAATCAGGAAGTGCAGGG + Intergenic
925797912 2:7566802-7566824 CAGAGGGAAGAGCATGTGCAAGG - Intergenic
926793926 2:16603239-16603261 CAGACAGAGCAGCATGTGCAAGG - Intronic
927701914 2:25274501-25274523 CAGAGGAAACAGCACCAGCAAGG - Intronic
928531904 2:32201002-32201024 AAGTGAAAGCAGCATGTGCAGGG - Intronic
929241702 2:39660140-39660162 CAGAGTAAACAGCCAGTGCAAGG - Intergenic
929521905 2:42660530-42660552 CAGAGAAAGCAGTAAGTGCCAGG - Intronic
930186270 2:48415214-48415236 CAAGGGAAGCAGCATGCACAGGG + Intergenic
930841235 2:55848192-55848214 CACAGGAAGAAGTATGTCCAAGG + Intergenic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
930924525 2:56800632-56800654 CAGAAGAAACAGCAGATGCAAGG + Intergenic
930989156 2:57629774-57629796 CAAAGCAACCAGCATGTACAAGG + Intergenic
932055056 2:68434936-68434958 CAGAGGAAACTGCAAGTGCACGG + Intergenic
932089338 2:68791004-68791026 CGAAGGAAACAGCAAGTGCAAGG - Intronic
932206118 2:69884539-69884561 CTGAGGAGACTGCATGTGCAAGG - Intergenic
932399929 2:71473287-71473309 CAAAGGCAGCAGCAAGTGAAAGG - Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
933267230 2:80194264-80194286 CTGAAGCATCAGCATGTGCAGGG - Intronic
934042081 2:88135944-88135966 CAGAGGAAGCACCTTTTTCATGG - Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934165300 2:89288813-89288835 CAGAGACAGCAGCATGACCATGG - Intergenic
934173535 2:89559456-89559478 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934201974 2:89893649-89893671 CAGAGACAGCAGCATGACCATGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934283849 2:91633809-91633831 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
935203796 2:100880937-100880959 CCAAGAAAGCAGCAAGTGCAGGG + Intronic
935802758 2:106715043-106715065 CAGACAAGGCAGCATCTGCAAGG - Intergenic
936660302 2:114535959-114535981 CAGAGAGAGCAGCATGTGTAAGG - Intronic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
937256274 2:120557998-120558020 CACAGGGAGCAACATTTGCAAGG - Intergenic
937346341 2:121128117-121128139 CCTAGGCAGCAGCATGTGGAAGG - Intergenic
938110249 2:128559610-128559632 CAGAGGAGGCAGCGAGTGCAAGG + Intergenic
938170260 2:129069687-129069709 CAGAGGCAGCAGCCTCTGCAGGG - Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
940201197 2:151152802-151152824 CAGAGGGAACAGCAACTGCAAGG - Intergenic
940985876 2:160051761-160051783 TGCAGCAAGCAGCATGTGCATGG + Intronic
940996559 2:160156412-160156434 CAGAGGATGCAGGAGGTGCTTGG - Intronic
941361414 2:164556596-164556618 CACAAGCAGTAGCATGTGCAAGG - Intronic
941629267 2:167866055-167866077 CAAAGGAAACAGCATATGCAAGG - Intergenic
941934856 2:170974358-170974380 CAGAGGGAACAGCGTCTGCAAGG + Intergenic
941969782 2:171337155-171337177 AAGAGGAAGCAGACTGGGCATGG - Intronic
942749765 2:179274678-179274700 CAGAGGAAACAGCATATGAAAGG + Intergenic
943684858 2:190807794-190807816 GACAGGAAACAGCATGTGAAAGG - Intergenic
943848802 2:192689082-192689104 CAGAGAAGACAGCTTGTGCAGGG - Intergenic
943936906 2:193930419-193930441 CAGAGATAGCAGCATGGACAAGG + Intergenic
944634107 2:201657841-201657863 GAGAGTAAGGAGCATGAGCAGGG - Intronic
944827518 2:203500312-203500334 CAGAGGAACCAACATATACAAGG + Intronic
944869636 2:203896934-203896956 CAGAGGAAGGAGCTTGAGAAAGG + Intergenic
945006872 2:205417813-205417835 CAGAGGAGGCCCCATCTGCAGGG - Intronic
945019650 2:205557967-205557989 AAGAGGAAGCAGCACCTGCATGG + Intronic
945679771 2:212899760-212899782 CAAAGAAAGAAGCATGTGCAAGG + Intergenic
947074491 2:226327561-226327583 CAGAGCAAGCAGGAAATGCAGGG + Intergenic
947185419 2:227451028-227451050 CAGAGGAAGCAACCTGGGCTAGG - Intergenic
948057421 2:235019021-235019043 CAGAGGGAACAGCTAGTGCAAGG + Intronic
948380382 2:237546539-237546561 CACAGGGAGGAGCATGGGCATGG - Intronic
948460887 2:238129404-238129426 CAGAGGGAACAGCCAGTGCAAGG + Intronic
948868880 2:240788472-240788494 CAGAGGGAACAGCATGTGAAAGG + Intronic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168812872 20:717660-717682 CTGAGGAAACAGCACGTGCAAGG - Intergenic
1169293869 20:4375967-4375989 CATAGGAAGCGGTATGTGAAAGG + Intergenic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170457192 20:16544243-16544265 CAGAAGGACCAGCATGAGCAAGG - Intronic
1170651379 20:18245596-18245618 CAGAGGGACCAGCATGTTCAAGG - Intergenic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171347879 20:24479515-24479537 CAGAGGAAGGGGCATGGGAAGGG - Intronic
1172166569 20:32903209-32903231 CGGAGGGAGCAGCCTATGCAAGG - Intronic
1172422497 20:34829079-34829101 CAGGGGGATCAGCATGTGCAAGG - Intergenic
1172530918 20:35630846-35630868 CAGAGGCTGAAGCATCTGCAGGG + Intronic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1172631002 20:36378096-36378118 CAGAGGCAGCAGGAGTTGCAAGG + Intronic
1172784303 20:37456400-37456422 CAGAGGAAGAAGCCTGTGCTGGG - Intergenic
1173248265 20:41350718-41350740 CAGAGGAAACAGTATGTGCCAGG + Intronic
1173646880 20:44638921-44638943 CAGAAGGAACAGCATGTGCAAGG + Intronic
1173847204 20:46195752-46195774 CAGTGGAAGGAGCGTCTGCATGG + Intronic
1174050481 20:47764071-47764093 CAGAGGGAGCAGCAAGTTCAAGG - Intronic
1174068498 20:47883236-47883258 CAGAAGGAGCAGCAGGTGCTGGG + Intergenic
1174115085 20:48221279-48221301 CAGGAGAAGCAGCCTGTGCCAGG + Intergenic
1174251872 20:49225982-49226004 CAGAGGGAACAGAAAGTGCAAGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174438339 20:50528075-50528097 CAGAGGAAACAGCATATGCAAGG - Intronic
1174781640 20:53394898-53394920 CAGTGGAGGCTGCATGTGGAGGG - Intronic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175191432 20:57214585-57214607 CAGCGGAAACAGCATGTGTGAGG - Intronic
1175452796 20:59084243-59084265 CAAAGGAGCCAGCATGTGCCTGG - Intergenic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379209 21:6103391-6103413 CAGAGGCAGCGGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176715628 21:10346918-10346940 CAGAAGAAACAGCAGGTACAAGG - Intergenic
1177034372 21:16023584-16023606 TACAGGAAGAAGCATGTGAAAGG - Intergenic
1177768551 21:25488278-25488300 TACAGGCAGCAGCAAGTGCAGGG - Intergenic
1178111049 21:29370504-29370526 CTAAGGAAGTAGCATGTGGAAGG + Intronic
1178157372 21:29871004-29871026 CAGAGTCAGAAGCATTTGCAAGG - Intronic
1179021065 21:37641615-37641637 CAGAGGGAACAGCATTTGCAGGG + Intronic
1179080483 21:38166224-38166246 AAGAGCAAGCAGCATGTTCCAGG - Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179238698 21:39569416-39569438 CAGAGGAAGTAGCCAGGGCAGGG - Intronic
1179421472 21:41240111-41240133 CATAGGAAGCAGAATGTGGCTGG + Intronic
1179608258 21:42532393-42532415 CTGAGGGAGAATCATGTGCAGGG - Intronic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744264 21:43434846-43434868 CAGAGGCAGCGGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179766100 21:43574251-43574273 CAGAGGAGTCAGCCAGTGCATGG - Intronic
1180602719 22:17033035-17033057 CAGAAGAAACAGCAGGTACAAGG + Intergenic
1181039020 22:20183264-20183286 CACAGGAAGCATCATGAGCCAGG - Intergenic
1181049538 22:20231989-20232011 CAGAGGGAACAGCCTGTGCGGGG - Intergenic
1181148630 22:20866702-20866724 CAGAGGGTGCAGCTTGTGCAGGG - Intronic
1181260174 22:21591756-21591778 CAGAGGAAGCAGCCTGGCGAAGG + Intronic
1181343618 22:22201448-22201470 CAGAGAAAGCAGCAGCTGCTGGG - Intergenic
1181442205 22:22942377-22942399 CTGAGGAAGGAACACGTGCAGGG - Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182051339 22:27315104-27315126 CAGAGGGAACAACAGGTGCAAGG + Intergenic
1182353605 22:29712330-29712352 CAGAGCACACAGCAAGTGCAAGG + Intergenic
1182815037 22:33154962-33154984 CAAAAGAAGAAGCTTGTGCAGGG - Intergenic
1183281404 22:36934638-36934660 CAGTGCACGCAGCAAGTGCAGGG - Intronic
1183316283 22:37138799-37138821 CAGTGGGATCGGCATGTGCAAGG + Intronic
1183517424 22:38274891-38274913 CAGAGGGAACAGCTAGTGCAGGG - Intergenic
1183618115 22:38957166-38957188 CACAGGATGCAGCAGGTGCCAGG + Intronic
1183670172 22:39268239-39268261 CAGAGGAAGGAGCGTGGGCATGG - Intergenic
1183724568 22:39581259-39581281 CTGAGGAAGCAGCCTGATCAAGG + Intronic
1184128866 22:42505377-42505399 GCGTGGAAGCAGCATGTGCTTGG - Intergenic
1184137661 22:42558692-42558714 GCGTGGAAGCAGCATGTGCTTGG - Intronic
1184264896 22:43341757-43341779 CAAAGGGAGCAGCCTGTGCTAGG - Intronic
1184763180 22:46557173-46557195 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1185151684 22:49167441-49167463 CAGAGGAACCAGCCTGGGCTAGG - Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
949613324 3:5726890-5726912 CAGAGGAAACAGCGTGTGTTAGG + Intergenic
949619334 3:5792658-5792680 CAGAGGACATAGCATGTACAAGG + Intergenic
949944194 3:9177366-9177388 CAGAGGGAGCAGCAAGTTCAAGG + Intronic
950074907 3:10180523-10180545 GAGAGGGGCCAGCATGTGCAAGG + Intronic
950245536 3:11413836-11413858 CAGTGGAACCATCAGGTGCAGGG + Intronic
950369656 3:12518407-12518429 CAGAGGAAGCAGTGCATGCAGGG - Intronic
950443851 3:13024862-13024884 AAGAGGAAGTAGCTTGTGTAGGG - Intronic
950577563 3:13841967-13841989 CAGAGGGAACAGTAAGTGCAAGG + Intronic
950651709 3:14411327-14411349 CTGAGGGACCAGCATGGGCAGGG - Intronic
950663147 3:14479419-14479441 CAGAGGAGCCAGCCTGTGCGGGG + Intronic
950681134 3:14585858-14585880 CAGAGGGGACAGCAGGTGCAAGG + Intergenic
950762339 3:15243151-15243173 CAGAGGGAACAGCAAGTACAAGG + Intronic
950825054 3:15809929-15809951 CAGAGGAAACAGCATCTGCAAGG - Intronic
950952185 3:17011950-17011972 CAAATAAAGAAGCATGTGCAAGG - Exonic
951942234 3:28092139-28092161 CAGAGGAAAAAACATGTGCATGG + Intergenic
952119391 3:30223819-30223841 CAGGTGAAGCAGCATGTGTCAGG - Intergenic
952277559 3:31892181-31892203 CAGAGGAAGGAGCACGTGTATGG + Intronic
952620193 3:35328909-35328931 CAGGCAAGGCAGCATGTGCAGGG + Intergenic
952850244 3:37722114-37722136 CAGAAGAACCAGCATGTGTGGGG - Intronic
953575777 3:44112155-44112177 CAGAGGAAGCAGCTTGTGTGAGG + Intergenic
953600589 3:44359962-44359984 CAGAGGCAGCAGCTAGGGCAAGG - Intronic
954070634 3:48140367-48140389 CGGAGGGAGCAGCATGTTCAGGG + Intergenic
954383028 3:50229660-50229682 CAGAGGCAGCAGCAAGTGCAAGG - Intronic
954417037 3:50398303-50398325 GGGAGGGAGCAGCATGTGCAGGG - Intronic
954757840 3:52851476-52851498 CAGAGGGCGCAGCCTGTGCTAGG + Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
954805397 3:53216960-53216982 CAGAGGAAGCACCAGGTGGGAGG - Intergenic
954924498 3:54220609-54220631 CAGAGGAAGCAGCAGGTGTGGGG - Intronic
955038186 3:55289350-55289372 CAGACGAGTGAGCATGTGCAGGG - Intergenic
955040230 3:55309554-55309576 CAGAGGCAACAGCAAGTGCCAGG + Intergenic
955306371 3:57837119-57837141 CATAGGAAAAAGCATGTGCAAGG - Intronic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
955761192 3:62284926-62284948 CAGAGGAAAGAGGATTTGCAGGG - Intronic
955796220 3:62639892-62639914 AAGAGGAAACAGCAAGTGCAAGG - Intronic
955908372 3:63831854-63831876 CAGAAGCAGCAGCAGGTACATGG - Intronic
956191220 3:66610280-66610302 CAGGGGCAGGAGGATGTGCATGG + Intergenic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
956598101 3:70990750-70990772 TAGAGGGAGCTGCTTGTGCAGGG + Intronic
956677840 3:71752839-71752861 CAGAGGTACCAGCACATGCAAGG + Intronic
957061988 3:75489739-75489761 CAGAGGGAACAGCATGTGTGAGG - Intergenic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957382945 3:79457702-79457724 CAGGTGAAAGAGCATGTGCAGGG - Intronic
957945133 3:87053595-87053617 AAGAGGAGGAAGAATGTGCATGG + Intergenic
958643181 3:96835459-96835481 CAGAGGGAGTATCAAGTGCAAGG + Intronic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959911631 3:111770162-111770184 CAGAGGAAGCACCTTCTACAAGG - Intronic
960417704 3:117405486-117405508 CTGAGGAGGCAGCAGGGGCATGG + Intergenic
960822804 3:121752238-121752260 TAGATGGAGCAGCATGTGCATGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961291415 3:125849662-125849684 CAGAGGGAACAGCATGTGTGAGG + Intergenic
961324394 3:126101740-126101762 GAGAGGCAGCTGCATGTGCTTGG + Intergenic
961630459 3:128294756-128294778 CAGAGGAAACAGCATATGCAAGG + Intronic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961668501 3:128509204-128509226 CATGGGAAGAAGCATGTGCATGG - Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962092287 3:132257180-132257202 CAGAGGGAGCAGCACATTCAGGG + Intronic
962423151 3:135245911-135245933 CAGAAGACTCAGCATGTGCATGG + Intronic
963011003 3:140770451-140770473 CAGAGCAGGGAGCATGTGCTGGG - Intergenic
963068287 3:141281284-141281306 TGGAGTAAGCAGCAAGTGCAGGG + Intronic
963123491 3:141795163-141795185 AAGAGGAAGGAGCATGCGCTAGG + Intronic
963231986 3:142917031-142917053 CAGAGGGGGTAGCATGTGCTTGG - Intergenic
963504368 3:146165027-146165049 CAGAAGAAACAGGAAGTGCAAGG + Intergenic
963771750 3:149393296-149393318 CAGAGGAAGTAGCATGGGAAAGG - Intergenic
964214064 3:154259676-154259698 GAGAGAAAGCAGCATTGGCAAGG + Intergenic
964816836 3:160726895-160726917 CAGAGGGAATAGCAGGTGCAAGG - Intergenic
965420628 3:168454095-168454117 CAACGGAAGAAGCTTGTGCAGGG + Intergenic
965670093 3:171138976-171138998 AAGTGGAAGCTGCATGAGCAAGG + Intronic
965899126 3:173617068-173617090 TAGAAGGATCAGCATGTGCAAGG - Intronic
966627094 3:182029278-182029300 AACAGGAAACAGCATGTACAAGG + Intergenic
967096560 3:186182048-186182070 CTGAGGAAGCACCAAGGGCATGG - Intronic
967198262 3:187048396-187048418 CAGAGGATGCAGCAAGTGTCAGG - Intronic
967949733 3:194831629-194831651 TAGAGGGAGCTGCATCTGCAAGG + Intergenic
968866400 4:3215412-3215434 CAGAGACAGCCGCATGTGTACGG - Intronic
969005882 4:4019830-4019852 CAGAGGGAACAGCATGTGTGAGG - Intergenic
969119805 4:4899823-4899845 CAGAGAAAACAGTATGTGCCAGG - Intergenic
969184253 4:5463764-5463786 AAGAGAAAGCGGCCTGTGCAAGG - Intronic
969190442 4:5514023-5514045 CAGACAAGGGAGCATGTGCAGGG + Intergenic
969293147 4:6253242-6253264 CAGAGGGAACAGCAAGTGTAAGG + Intergenic
969807067 4:9617460-9617482 CAGAGGGAACAGCATGTGTGAGG + Intergenic
969827395 4:9768272-9768294 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
970006611 4:11416956-11416978 CAGAGGAAACAGTATGCGTAGGG + Intronic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
970430371 4:15983561-15983583 CAGAAGAAACGGCATGTGCATGG + Intronic
970473795 4:16402081-16402103 AACAGGAGGGAGCATGTGCAGGG + Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
970902830 4:21179276-21179298 CAGAGTGAGCAGAAAGTGCAAGG - Intronic
971045526 4:22801414-22801436 CAAGGGAAGTATCATGTGCAAGG + Intergenic
971313859 4:25550527-25550549 TAGAGGGAACAGCAAGTGCAAGG + Intergenic
971470558 4:27021439-27021461 CAGAGGGAACAGCAAATGCAGGG + Intronic
971477510 4:27086271-27086293 CAGAGGAAACCCCATGTTCATGG + Intergenic
972199483 4:36696851-36696873 CAAAGGAAGCAGAATGGGCAAGG - Intergenic
972352668 4:38251465-38251487 CAGAGGAAGGATTATGAGCAGGG - Intergenic
972599576 4:40560354-40560376 TTGAGGAATGAGCATGTGCATGG + Intronic
973160975 4:47016046-47016068 TAGAGGATGCAGCAGGTGAAAGG + Intronic
974264399 4:59565609-59565631 CAGAGAGAAAAGCATGTGCAAGG - Intergenic
974431030 4:61796215-61796237 GAGAGGTGGCAGCATGTGCAGGG - Intronic
974886784 4:67828997-67829019 GAGAGGAATGAGCATGAGCATGG - Intronic
974925305 4:68291450-68291472 CAGGCAAAACAGCATGTGCAGGG + Intergenic
975329648 4:73099447-73099469 GTGGGGATGCAGCATGTGCAGGG - Intronic
975405818 4:73988026-73988048 CAGAAGCAGCAGCACCTGCAAGG + Exonic
975411339 4:74054667-74054689 CAGAAGCAGCAACAGGTGCAAGG + Intergenic
975523990 4:75329433-75329455 CAGAGAAAATAGCATGTCCAAGG - Intergenic
975788574 4:77922289-77922311 CAGAAGAAACAGCAAATGCAAGG + Intronic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976410115 4:84703612-84703634 CAGAGGGAAGAGCTTGTGCAAGG - Intronic
976584330 4:86778371-86778393 CATAGCAAGCAGCATGAGCATGG + Intronic
976842755 4:89451109-89451131 CAGAGGCAGCAGTTGGTGCAAGG + Intergenic
977512174 4:97974664-97974686 AAGAGGAGGGAGCTTGTGCAGGG - Intronic
978465647 4:109005844-109005866 CAGAGCTAACAGCATGTGCTAGG + Intronic
978667470 4:111201888-111201910 CAGAGCAAACAGTATGTGTAAGG - Intergenic
981497712 4:145412260-145412282 CAGAAGAAACAGCTAGTGCAAGG - Intergenic
982112125 4:152066347-152066369 CAGAGGAGACAGCATGAACAAGG - Intergenic
982168342 4:152636958-152636980 CAGAGGAAGAATCATGCACAAGG + Intronic
982317557 4:154047049-154047071 CAGAGGGAGCAGCCCGGGCAAGG + Intergenic
982449403 4:155534062-155534084 CAGAGGAAACAGGATGAGCTGGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983971053 4:173874886-173874908 CAGAGGGAGTAGTATGTTCAAGG + Intergenic
984140742 4:176001781-176001803 CAGAGGAAGGTGCTGGTGCAGGG - Intronic
984290653 4:177789719-177789741 AATAGGAAACAGCATGTGGATGG + Intronic
984462335 4:180054331-180054353 CACAGGAAACAGAATTTGCAAGG + Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
984555548 4:181209989-181210011 AAGAGGAAGCAGCATATTAAGGG - Intergenic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
985602410 5:842162-842184 CTGTGGAAGCAGCATGTTCCAGG + Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985958397 5:3281591-3281613 CCGTGGAAGCAGCGAGTGCAGGG + Intergenic
985964520 5:3329783-3329805 CTGAGAAAGCTGCCTGTGCACGG - Intergenic
986284503 5:6349434-6349456 CAGAGGGAGCCGCCTGTGCTCGG - Intergenic
986363974 5:7011077-7011099 CAGAGGACACAGCATGTATAGGG + Intergenic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
987077166 5:14394615-14394637 CAGAGGAAGCCTCCTGGGCATGG - Intronic
987119450 5:14753047-14753069 CTGAGGAAGCAGCATAGGCCAGG + Intronic
987924874 5:24327785-24327807 CTGAGGAAACACCATGTGAAAGG - Intergenic
988070870 5:26286275-26286297 GAGAGGAGACAGCTTGTGCAGGG + Intergenic
988322466 5:29716567-29716589 CAGAGGAAGCAGGATAGGAAAGG - Intergenic
988623466 5:32847001-32847023 CAGAGGAAGAGGCCTGGGCATGG + Intergenic
989558804 5:42827746-42827768 CAGATGAAAGAGCACGTGCAAGG + Intronic
990701748 5:58481882-58481904 CAGAGGGGGCAGCATGTGTAGGG + Intergenic
990943465 5:61227078-61227100 AAGAGGAGCCAGCCTGTGCAGGG - Intergenic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
992406041 5:76458895-76458917 CAGAGCATGCAGCCTGTGCAGGG + Intronic
992881501 5:81114735-81114757 CAGAGGAAAGAACAAGTGCAAGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993003162 5:82403151-82403173 CAGAGTGAATAGCATGTGCAAGG + Intergenic
993015814 5:82533291-82533313 CACATGAAGGAGCATGAGCATGG + Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
994107531 5:95962942-95962964 CACAGGAAGCATCCTGTGGATGG - Intergenic
994743459 5:103649473-103649495 TAGAGGGAGCAGCAAGTGGAAGG + Intergenic
995502724 5:112825492-112825514 CAAAGGAAACAGCATGTGAAAGG - Intronic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
996385607 5:122906924-122906946 CAGAGTAAGCTGCATGAGCAGGG - Intronic
996471564 5:123867239-123867261 CAGAGGAAACAGTATGTGCCAGG + Intergenic
996594049 5:125181338-125181360 CAGAAGATGCAACATGTGCAGGG - Intergenic
997249645 5:132378522-132378544 CTGAGGAAGAAGCGTGTGCCTGG + Intronic
997696306 5:135863808-135863830 AGGAGGAAGGAGCATGTGGAGGG + Intronic
998660887 5:144236372-144236394 CAGAAGGAACAGCATATGCAGGG + Intronic
999149233 5:149415797-149415819 CAGAGGAAGCTGCATGTTCAAGG - Intergenic
999233460 5:150076750-150076772 CAGAGGGAGGAACATATGCAAGG - Intronic
999283015 5:150377117-150377139 CAGAGGAAGCAGTCTGTGCGAGG + Intronic
999378789 5:151105460-151105482 CAGAGGAGGAAGCATGGGGAAGG - Intronic
999430683 5:151522742-151522764 CAGAGGGAGCAGCAAGTGTAAGG + Intronic
999463005 5:151772541-151772563 AAGAGGGAGCAGCGAGTGCACGG + Intronic
1001156688 5:169278607-169278629 CAGAGGAAGTAGCAGAAGCAGGG - Intronic
1001633540 5:173194063-173194085 CAGATGAAGCACAATGTGGATGG - Intergenic
1002282104 5:178137142-178137164 GTGAGGAAGCAGCATGTACCAGG + Intronic
1002745141 5:181464208-181464230 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1003095089 6:3136191-3136213 CAAAAGTAGAAGCATGTGCAGGG + Intronic
1003146098 6:3511860-3511882 AAGGGGAACCAGCGTGTGCAGGG - Intergenic
1003203595 6:3987151-3987173 CATAGGAAGCAGGATGTAAATGG - Intergenic
1003909238 6:10728304-10728326 TAGAGGAAGTAGCGTCTGCAGGG + Intronic
1004240426 6:13916355-13916377 TAGAGGAAGCAACAGATGCAAGG - Intergenic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1006184547 6:32173675-32173697 CAAAGGGAACAGCATGTTCAAGG - Intronic
1006756674 6:36422323-36422345 CAGAGGGAGCAGCTTGTGCAAGG - Intronic
1006878361 6:37317831-37317853 CAGAGGAAACAGCCAGTGCAGGG + Intronic
1007172454 6:39873363-39873385 CGAGGGAAGCAGCAAGTGCAGGG - Intronic
1007272486 6:40649023-40649045 GAGAGCAAGCAGCTTGTCCAAGG - Intergenic
1007409233 6:41652236-41652258 CAGAGGAATCAGCGCCTGCATGG + Intronic
1008458377 6:51738795-51738817 CAGAGGGAGCAGCCAGGGCAGGG - Intronic
1008827456 6:55714588-55714610 CAGAATGAGCAGCAAGTGCAAGG + Intergenic
1008891510 6:56497869-56497891 CAAAGGAAGCAGCAGCTGGATGG - Exonic
1009451666 6:63808219-63808241 CAGAAGAAACAGCATGTTCTAGG + Intronic
1010389206 6:75318036-75318058 CAGAGGACACAGCATTTGCAAGG - Intronic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010760444 6:79716459-79716481 CAGAGGCAATAGCATATGCAAGG + Intergenic
1011510034 6:88090010-88090032 CAGACTAAGGAGAATGTGCAGGG + Intergenic
1011989737 6:93499548-93499570 CAAAGCAGGTAGCATGTGCAAGG + Intergenic
1012267802 6:97167683-97167705 CAGAGGGAGCAACATGTACAAGG - Intronic
1012490661 6:99779856-99779878 CAGTGGAAGCAGCATGGCCTGGG + Intergenic
1013932931 6:115556627-115556649 GAGATGAAGGAGCATGTGCCAGG - Intergenic
1015022381 6:128492186-128492208 TAGAGAAGGCAGCATGTGAAGGG - Intronic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1017369575 6:153689217-153689239 CAGAGGGAGAAGCATATGGAAGG + Intergenic
1017664448 6:156706075-156706097 TAGAGGAAACAGCTTGTTCATGG + Intergenic
1017726331 6:157278498-157278520 CAGAGGCATGAACATGTGCAGGG - Intergenic
1017784791 6:157746649-157746671 GAGAGGAAGGAGCCTTTGCAGGG + Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1019250049 6:170737754-170737776 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1019457324 7:1137207-1137229 TCGAGGAAACAGCAGGTGCAGGG - Intronic
1019640891 7:2103115-2103137 CAGAGGCAGCAGCAAGCGCAGGG - Intronic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020496192 7:8855706-8855728 CAGAGGATGCAGCAGTGGCAAGG + Intergenic
1020600441 7:10268682-10268704 CACAGGAATCAGCATGTCCCTGG + Intergenic
1020725145 7:11803152-11803174 AACAGGCAGCAGCATGTTCATGG + Intronic
1020823151 7:12995656-12995678 AAGAGGGGGCAGCATGTGAAAGG + Intergenic
1020869185 7:13606581-13606603 CAGACAAGACAGCATGTGCAGGG - Intergenic
1021210244 7:17841906-17841928 CAGAGGAATCAGCAAATGTAAGG + Intronic
1022029470 7:26479173-26479195 CAGAACAAACAGCAAGTGCAAGG - Intergenic
1022392749 7:29957810-29957832 GAGAGGAAGGGGCATGTGAAGGG + Intronic
1022577194 7:31508875-31508897 AAGAGAAAGCAGCATCTACAGGG + Intergenic
1023184693 7:37521076-37521098 CAGAGGAAGCCTAATGTGAATGG + Intergenic
1023388577 7:39685262-39685284 CAGAGGAAGCTGCATGGCAAAGG + Intronic
1023609388 7:41957956-41957978 AAGAGGCAGCAGCATGGACAAGG - Intergenic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1027190066 7:75991345-75991367 GAGAGGTAGCAGCAGGTGGACGG - Intronic
1027534271 7:79376890-79376912 CACAGGAAGCTGCATATGGATGG - Intronic
1027729164 7:81847930-81847952 CAGAGGACACTGCATGTGCAAGG + Intergenic
1028503881 7:91550181-91550203 GAGAGGAAGCAGCAGGGGCTAGG - Intergenic
1029049592 7:97670564-97670586 CAGAGAAGACAGCAGGTGCAAGG - Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1030773327 7:113502067-113502089 CAGAGGTAGAAGCATGTCAAAGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032568871 7:132978379-132978401 GAAAGGAAGCAGCTTGTGAAAGG - Intronic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033833206 7:145277394-145277416 CAGAGAAAAGAGCCTGTGCAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034405607 7:150900702-150900724 CAGAGGAATCAGAAGATGCAAGG - Intergenic
1034867770 7:154656456-154656478 CAGCAGCCGCAGCATGTGCAGGG + Intronic
1035120421 7:156562040-156562062 CAGAGAAAGCAGCTGGTTCAGGG + Intergenic
1036062351 8:5337677-5337699 CAGATGAAGTACCATGTGCCTGG + Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1037068517 8:14613608-14613630 CAGAGCATGCAGAATTTGCAGGG + Intronic
1037250462 8:16887303-16887325 CAAAGGGATCAGCATGTGCATGG + Intergenic
1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG + Exonic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1038404064 8:27308956-27308978 TAGAGGCAGCAGCATTTGGAAGG - Intronic
1039273670 8:35911052-35911074 AAGAAGAAAGAGCATGTGCAGGG + Intergenic
1039329732 8:36523919-36523941 CAGAGGAAGCAAAAACTGCAAGG + Intergenic
1039950380 8:42167084-42167106 CAGAAAAAGCATCATGTGAAAGG + Intronic
1039981168 8:42410981-42411003 CCGAGGAAGCGGCATGCGGAAGG - Intergenic
1040555839 8:48476896-48476918 CAGAGGAGGCTGCATGGCCAGGG - Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1040957142 8:52990964-52990986 AAGAGGAAACAGGAAGTGCAAGG + Intergenic
1041007679 8:53511045-53511067 TAGGGGAAGCAGCAGGTCCATGG + Intergenic
1041278823 8:56190935-56190957 CAGAGGAAATAGCACGTGCAAGG + Intronic
1041795544 8:61743682-61743704 AACAGGAAGGAGCATGTGCCTGG + Intergenic
1042770265 8:72372895-72372917 CAGAAGAAACAGCATTTGCAAGG - Intergenic
1045508526 8:102795399-102795421 GAGAGGAAACAGCCTGTGGAGGG - Intergenic
1045820087 8:106326683-106326705 CAGAGGGACCAGCCAGTGCAAGG + Intronic
1046541692 8:115591710-115591732 CAAAGGAAACAGAAAGTGCAGGG + Intronic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1047712005 8:127561837-127561859 CAGAGGAAACGGCATATTCAAGG + Intergenic
1047717272 8:127607074-127607096 CAGAGGAAACAGTAAATGCAAGG + Intergenic
1048210737 8:132452451-132452473 GTGATAAAGCAGCATGTGCATGG - Intronic
1048555999 8:135476558-135476580 CAGAGGGAAAAGCAAGTGCAAGG - Intronic
1048850934 8:138644725-138644747 CAGAAGGAGAAACATGTGCATGG - Intronic
1049308982 8:141923441-141923463 CTGAGGATGGGGCATGTGCATGG - Intergenic
1049634686 8:143681230-143681252 CAAAGGATGCAGCCTGTTCAAGG - Intergenic
1050027336 9:1349604-1349626 CAAATAAAGCAGCATTTGCAGGG - Intergenic
1051145938 9:14027300-14027322 GACAGGAAGCAGCATGTGCTGGG - Intergenic
1052371003 9:27664325-27664347 CAGAGCAATCAGCAAGTGCGAGG - Intergenic
1053174810 9:35915046-35915068 CAGAGGAAGCACAATGTGCCTGG - Intergenic
1053304560 9:36974947-36974969 CAGAGGGAGCAGAATGTCCAGGG - Intronic
1053345280 9:37373536-37373558 CAGGAGGAGCAGCACGTGCAAGG + Intergenic
1055129100 9:72754079-72754101 CAGAAGAAGCAACATCTGCTTGG + Intronic
1055222875 9:73959194-73959216 CTGAGGAAGCAGCCTGGGGATGG + Intergenic
1055854038 9:80664515-80664537 AAAAGGGAGGAGCATGTGCAAGG + Intergenic
1055977318 9:81968001-81968023 CAGAGGGAGCAGCATCTTCTGGG - Intergenic
1056132759 9:83601931-83601953 CAGAGAGAGCAGCAAGTGCAAGG + Intergenic
1056486087 9:87059328-87059350 CAGGCAAGGCAGCATGTGCAGGG - Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057396920 9:94688881-94688903 CTGAGGAAGCAGCCTGTGCCAGG + Intergenic
1057425708 9:94947757-94947779 TAGAGGAGGAAGCAGGTGCATGG + Intronic
1057487093 9:95494217-95494239 CAGAGGGAGCAGCCTGGGCAAGG - Intronic
1057691277 9:97288717-97288739 CAAAGGAAGCTGCATGGACATGG + Intergenic
1057940590 9:99279539-99279561 CAGAGGAGGAAGTATGTGTAAGG - Intergenic
1058095197 9:100852304-100852326 CAGAGGGAGCAGCACATGCAAGG - Intergenic
1059247233 9:112858839-112858861 CAGAGAAGCCAGCATGTGTAGGG - Intronic
1059691664 9:116690733-116690755 CAGAGAAAGTAGCCTGTCCAAGG - Intronic
1059700487 9:116771174-116771196 TAGAGGAAGCATGAAGTGCAAGG - Intronic
1059764648 9:117372222-117372244 GAGAGGAAGAGGCAGGTGCAGGG - Intronic
1060162031 9:121372523-121372545 TAGAGGGAAAAGCATGTGCAAGG + Intergenic
1060853181 9:126894499-126894521 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1060976296 9:127767089-127767111 GAGAGGGAGCAGAATGTGCTGGG - Intronic
1061234341 9:129333923-129333945 CAGAGGAGGCAGCAAGTGTGAGG - Intergenic
1061553292 9:131350216-131350238 CAGAGGGAGCTGCGAGTGCAAGG + Intergenic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1061846158 9:133389523-133389545 CAGTGGATGCAGAATGTGCTGGG + Exonic
1062185148 9:135214266-135214288 CAGAGGAAGGTGCTGGTGCAGGG + Intergenic
1062192308 9:135254321-135254343 CAGTGGAGGCAGCAGGTGCTGGG - Intergenic
1062248661 9:135583432-135583454 CGGAGGAAGCAGCATCTGGGGGG + Intergenic
1062359561 9:136181255-136181277 CACGGGAAGCAGCATCTTCAAGG + Intergenic
1062410586 9:136422178-136422200 CCAAGGAGGCAGCAGGTGCATGG - Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1062697233 9:137881621-137881643 CTGAGGGAGCTGCATGTGCAGGG - Intronic
1203784675 EBV:120893-120915 CACGGGACGCAGAATGTGCAGGG - Intergenic
1203791121 EBV:152116-152138 CAGAGGCCCCAACATGTGCAGGG - Intergenic
1203579611 Un_KI270745v1:30339-30361 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1185954321 X:4472740-4472762 CAGAGGAAACTGCAGGTGCTGGG - Intergenic
1186136836 X:6530121-6530143 CAAAGGAAGCTGCATGGTCAAGG + Intergenic
1186267506 X:7848309-7848331 CAGAGGAAGCTGCATGGTCAAGG - Intergenic
1186297539 X:8166560-8166582 CAGAGGAAGCTGCATGGTCAAGG + Intergenic
1186376661 X:9010699-9010721 CGGAGGAAGCTGCATGGTCAAGG - Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1188685129 X:33060234-33060256 AAGAGGAAGCATCATGGGTAAGG + Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189212206 X:39292949-39292971 CAGAGGAAGCAGCCTAAACAAGG + Intergenic
1190212055 X:48456820-48456842 CAGAGGGAGCAACAGGTGCAAGG - Intergenic
1191730736 X:64332526-64332548 CAGAAGCAGCAGTAGGTGCAAGG - Intronic
1192080887 X:68046812-68046834 CTGAGGAAGCAGGAAGTTCAGGG + Exonic
1192232561 X:69276019-69276041 CAGAGGAAACAGCCAGTTCAAGG + Intergenic
1192268777 X:69558947-69558969 CCGAGGAAACAGCATGTGCAAGG + Intergenic
1192285272 X:69728451-69728473 CAGAGGAAACAATATGTGCAAGG + Intronic
1192291931 X:69806776-69806798 CAGAGGAAATGGCATGTGCAAGG + Intronic
1192508314 X:71704807-71704829 CAGGGAAGACAGCATGTGCAGGG - Intergenic
1192511146 X:71721057-71721079 AAGAGGAGGGAGCATGAGCAGGG - Intergenic
1192512359 X:71730091-71730113 CAGAAAAGACAGCATGTGCAGGG + Intergenic
1192514338 X:71751418-71751440 CAGAAAAGACAGCATGTGCAGGG - Intergenic
1192515551 X:71760496-71760518 AAGAGGAGGGAGCATGAGCAGGG + Intergenic
1192518382 X:71776746-71776768 CAGGGAAGACAGCATGTGCAGGG + Intergenic
1192527037 X:71855926-71855948 CAGGGAAGACAGCATGTGCACGG - Intergenic
1195905338 X:109838873-109838895 CAGAAAAATCAGCATGTGTAAGG - Intergenic
1196779891 X:119374461-119374483 CAGAAGAAACTGCATGTGCAAGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1196946682 X:120833373-120833395 CAGTGGATGCAGCCTATGCAGGG - Intergenic
1197922934 X:131614687-131614709 CAGAGGGAACAGCAAGTGCTCGG - Intergenic
1198023681 X:132683779-132683801 CAGAGCAAGTAGCATGGGCCAGG + Intronic
1198131365 X:133698636-133698658 CAGAGGACGGAGCTTGGGCATGG + Intronic
1198523444 X:137475355-137475377 CGGAGGAGATAGCATGTGCAAGG + Intergenic
1199805871 X:151299868-151299890 AAGAGGAAACAGAATGGGCAGGG - Intergenic
1199849715 X:151716750-151716772 CAGAGGAAACAGCAAATGCAAGG - Intronic
1200283838 X:154802116-154802138 CAGAGGGAACAGCCTGTGCACGG - Intronic
1201438215 Y:13981665-13981687 CAGAGGAAGCTGCATGGTCAAGG + Intergenic
1201446365 Y:14060440-14060462 CAGAGGAAGCTGCATGGTCAAGG - Intergenic
1201591926 Y:15625110-15625132 CAGAGGGAGCAGCGTGTGGCTGG + Intergenic