ID: 1080636364

View in Genome Browser
Species Human (GRCh38)
Location 11:34127297-34127319
Sequence TGGCAGGGCAAAAATGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 228}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080636364_1080636378 30 Left 1080636364 11:34127297-34127319 CCCATCCCATTTTTGCCCTGCCA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1080636378 11:34127350-34127372 AGAAGGAAACAGGGAGAGAGAGG 0: 1
1: 1
2: 52
3: 707
4: 3996
1080636364_1080636372 -4 Left 1080636364 11:34127297-34127319 CCCATCCCATTTTTGCCCTGCCA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1080636372 11:34127316-34127338 GCCAGGAAAAAGTAGAAAGGAGG 0: 1
1: 0
2: 3
3: 45
4: 439
1080636364_1080636374 5 Left 1080636364 11:34127297-34127319 CCCATCCCATTTTTGCCCTGCCA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1080636374 11:34127325-34127347 AAGTAGAAAGGAGGAATGAGAGG 0: 1
1: 0
2: 4
3: 90
4: 866
1080636364_1080636375 13 Left 1080636364 11:34127297-34127319 CCCATCCCATTTTTGCCCTGCCA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1080636375 11:34127333-34127355 AGGAGGAATGAGAGGAGAGAAGG 0: 1
1: 2
2: 17
3: 345
4: 2698
1080636364_1080636371 -7 Left 1080636364 11:34127297-34127319 CCCATCCCATTTTTGCCCTGCCA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1080636371 11:34127313-34127335 CCTGCCAGGAAAAAGTAGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 283
1080636364_1080636376 20 Left 1080636364 11:34127297-34127319 CCCATCCCATTTTTGCCCTGCCA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1080636376 11:34127340-34127362 ATGAGAGGAGAGAAGGAAACAGG 0: 1
1: 0
2: 7
3: 104
4: 1108
1080636364_1080636377 21 Left 1080636364 11:34127297-34127319 CCCATCCCATTTTTGCCCTGCCA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1080636377 11:34127341-34127363 TGAGAGGAGAGAAGGAAACAGGG 0: 1
1: 2
2: 10
3: 141
4: 1669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080636364 Original CRISPR TGGCAGGGCAAAAATGGGAT GGG (reversed) Intronic
900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG + Intergenic
900959889 1:5912171-5912193 GGGCAGGGGAGCAATGGGATGGG + Intronic
901326729 1:8371089-8371111 TGCCTGGGCAGAAATGGGAAAGG + Intronic
903152971 1:21426056-21426078 TGGAAGCCCAAACATGGGATGGG - Intergenic
903160161 1:21481925-21481947 TGGAAGCCCAAACATGGGATGGG + Intronic
904863223 1:33556280-33556302 TTGCTGGTCATAAATGGGATTGG + Intronic
905020788 1:34809870-34809892 TAGAAGGGCAAAAGTGGGAGGGG + Intronic
905861777 1:41356938-41356960 GGGCAGGGAAAAAATGAGCTTGG - Intergenic
905886677 1:41495574-41495596 GGGCAGGGCCATACTGGGATGGG - Intergenic
907419306 1:54336252-54336274 AAGCAGGGCAAATATGAGATGGG + Intronic
907465268 1:54630912-54630934 CGTCAGGGTAACAATGGGATGGG + Intronic
907747079 1:57224004-57224026 TGGAAGGGCAACAAAGGAATCGG - Intronic
908463125 1:64365829-64365851 AGGGATGGCAAAAATGTGATGGG + Intergenic
909662993 1:78104613-78104635 TGTAAGGGTAAAAATGGGGTAGG + Intronic
910095710 1:83519410-83519432 TGGCTGGGGCAGAATGGGATAGG + Intergenic
910609920 1:89129661-89129683 TGCCATGGCAAAACTGGGAAGGG + Intronic
911357405 1:96839186-96839208 TGTCAGGGAAGAAATGTGATTGG + Intergenic
912058235 1:105632050-105632072 TGGCAGGAGAAAAATGAGAGTGG - Intergenic
914003164 1:143709833-143709855 TGGGAGGGCATATGTGGGATGGG - Intergenic
915882295 1:159684799-159684821 AGGCAAGGAAAAAATGGGATTGG + Intergenic
917294511 1:173504922-173504944 TGGCAGTGCAAGAATGGGGAGGG - Intronic
917976652 1:180244298-180244320 TGGCTTGGCAAAAATGGAAGGGG - Intronic
918135197 1:181666854-181666876 TGGCAGGACAAAAATTGAGTTGG + Intronic
919177816 1:194041454-194041476 TGGGAGGTCAAAAATAGAATAGG - Intergenic
922746352 1:228046194-228046216 TGGCATGGCCAAACTGGCATTGG + Intronic
922988731 1:229886870-229886892 TGGCAGGGCAGAAATGTGGTAGG - Intergenic
923337827 1:232985431-232985453 TGTCAAGGCAAAAATGGGTCAGG - Intronic
1066710497 10:38228277-38228299 AGGCAGGGAAAAAATGGGGTGGG - Intergenic
1066979515 10:42399170-42399192 AGGCGGGGAAAAAATGGGGTGGG + Intergenic
1068392649 10:56418064-56418086 TGGCTGGACACAAATGGGAAAGG - Intergenic
1069515574 10:69074201-69074223 TGCCAGGGCAGAGGTGGGATGGG + Intergenic
1069517813 10:69093196-69093218 TGGCAAGGCCAAATTGGGACAGG + Intronic
1069998469 10:72358042-72358064 TGGAAAGGGAAAAATGGGAATGG - Intergenic
1070576981 10:77686885-77686907 TGGCAAGGCAAGAAAGTGATAGG - Intergenic
1071691102 10:87820223-87820245 TGGCAGGGCTAAAAGGGGGAGGG + Intronic
1075083097 10:119396943-119396965 TGGCAGGGCCAAGATGGGGATGG + Intronic
1076044820 10:127283274-127283296 TAGCAGGTCAGAAATGGGAAAGG + Intronic
1076125089 10:127967773-127967795 TGGAAGAGCAATAAGGGGATTGG - Intronic
1076401006 10:130185335-130185357 TGGCTGTGCAGAAATGTGATTGG + Intergenic
1077717416 11:4595577-4595599 TGGAAGGAGAAAATTGGGATTGG + Intergenic
1078669228 11:13350207-13350229 TGGCTGGTCAAAAAAGGGAGTGG + Intronic
1079277983 11:19059509-19059531 TGGTTGGGAAAAAAAGGGATTGG - Intronic
1079310352 11:19360153-19360175 TGGCAGGCCAAAGACAGGATGGG - Intronic
1079508399 11:21181485-21181507 GGGCATGGCAGAAATGAGATTGG + Intronic
1080096536 11:28415214-28415236 TTGCAGTGCCAAAATGGAATTGG + Intergenic
1080636364 11:34127297-34127319 TGGCAGGGCAAAAATGGGATGGG - Intronic
1080640809 11:34157344-34157366 TGGGAGGGCAAATAGGGGACAGG - Intronic
1083646470 11:64174221-64174243 TGGCAGGGTAAAAATGGGGGAGG - Intergenic
1083688315 11:64391032-64391054 GGGCAGGGCAAGAATGAGAGTGG + Intergenic
1086068171 11:82768651-82768673 TGGCAGTGCAACAATGGGTCAGG + Intergenic
1088374483 11:109125134-109125156 TGGCTGGGCAAATTTGTGATAGG + Intergenic
1088682229 11:112253323-112253345 GGGCTGGGCACAAAAGGGATGGG - Intronic
1089829663 11:121315761-121315783 TAGCATGGCTACAATGGGATGGG + Intergenic
1090072020 11:123552000-123552022 GGGGAGGAAAAAAATGGGATTGG - Intronic
1090609921 11:128461916-128461938 TGGGAGGGCAAAAAAGAGGTGGG - Exonic
1091730165 12:2874734-2874756 TCAAAGGGCAAAAATGGGACTGG + Intronic
1093453282 12:19339418-19339440 TGGCAGGTTAAATCTGGGATTGG - Intronic
1095951859 12:47785894-47785916 TGGGAGGGGAGAAATGGGAGGGG + Intronic
1096114759 12:49049397-49049419 TGGGAGGGGAAGAATGGGTTTGG - Intronic
1096656538 12:53096140-53096162 AGGAAGGGCAAAATTGGGAAAGG - Intergenic
1096656749 12:53097114-53097136 AGGAAGGGCAAAATTGGGAAAGG - Intergenic
1098176598 12:67798523-67798545 AGGCAGGGGAAAAATGGAAGAGG - Intergenic
1099527096 12:83729220-83729242 TGGCAGGGAAAGGATGGGACAGG - Intergenic
1099572113 12:84335589-84335611 GGGTAGGGGAAATATGGGATGGG + Intergenic
1100333795 12:93610663-93610685 TGGCAGGGCAAAAACGGACTAGG - Intergenic
1102257773 12:111426055-111426077 TAGCTGCGTAAAAATGGGATTGG + Intronic
1106579606 13:31005661-31005683 TGGAAAGTCAAGAATGGGATTGG - Intergenic
1106700715 13:32225403-32225425 TTGTAGAGCAAAAATGGGAAGGG + Intronic
1106841100 13:33685672-33685694 AAGCAGGACCAAAATGGGATAGG - Intergenic
1107840482 13:44451947-44451969 TGGGAGCGCAAAAGTGGGAAAGG - Intronic
1109011719 13:56957575-56957597 TTTCAAGGAAAAAATGGGATAGG - Intergenic
1114179085 14:20350015-20350037 GAGCAGGGCAATAATGGGAGGGG - Intronic
1114585952 14:23813801-23813823 AGGCCAGGCAAAACTGGGATAGG - Intergenic
1116747738 14:48843116-48843138 TGGCAGGGTAAAAAGGAGAAAGG - Intergenic
1117570000 14:57038287-57038309 TGGGAGGGCAAAAATTAGCTGGG - Intergenic
1118690261 14:68331829-68331851 TTGCAGGGAAAAACTGGGAAGGG + Intronic
1118741279 14:68741205-68741227 TGGCAGGGGATAAGAGGGATGGG - Intergenic
1120878239 14:89394036-89394058 TGGAAGGGCAAAGAGGGGAGTGG + Intronic
1121330939 14:93049502-93049524 TGGCAGGACCAAACTGGGAAGGG + Intronic
1121968102 14:98329194-98329216 TGGCAGGACAAAAAGAGAATAGG + Intergenic
1123466113 15:20517307-20517329 AAGCAGGGCAAAAAGGGGAGGGG - Intergenic
1123541316 15:21294668-21294690 TGGTGGGGCAATAATGGGAGGGG + Intergenic
1123652001 15:22483732-22483754 AAGCAGGGCAAAAAGGGGAGGGG + Intergenic
1123742421 15:23292592-23292614 AAGCAGGGCAAAAAGGGGAGGGG + Intergenic
1123760904 15:23431894-23431916 AAGCAGGGCAAAAAGGGGAGGGG - Intergenic
1124037878 15:26072984-26073006 TGTCAGGGCAAGAGTGGGGTGGG - Intergenic
1124165145 15:27319656-27319678 GGGCAGAGCACAAATGGGATGGG + Intronic
1124276837 15:28333283-28333305 AAGCAGGGCAAAAAGGGGAGGGG - Intergenic
1124305863 15:28578323-28578345 AAGCAGGGCAAAAAGGGGAGGGG + Intergenic
1124746220 15:32344115-32344137 TGGCTGGGCCAAAATGGGGGAGG - Intergenic
1128909486 15:71499369-71499391 TGGCATGGCAAAAATGTGCTAGG - Intronic
1129449271 15:75641030-75641052 TGCCCGGGCAAAAAGGGGTTAGG - Intronic
1131860142 15:96644973-96644995 TGGCAGGGCATAGTGGGGATGGG + Intergenic
1135019267 16:18949852-18949874 TAGCAGGGCAAAACTGGGTGTGG - Intergenic
1135347783 16:21704154-21704176 TGGAAGGGCAGAAGTGAGATTGG - Intronic
1136931120 16:34418718-34418740 TGGGAGAACAAAAATGGGAGAGG - Intergenic
1136973453 16:34993090-34993112 TGGGAGAACAAAAATGGGAGAGG + Intergenic
1138141392 16:54571632-54571654 TGGCAGAGCAAAGACGGGACTGG + Intergenic
1140227983 16:73094009-73094031 TGGCAGGGCAAAGGCAGGATGGG + Intergenic
1140414181 16:74761671-74761693 GGGCAGGGCAAAGTTGGGGTAGG - Intronic
1140496169 16:75390792-75390814 TGGCAGGGGAAGAAAGGGTTAGG - Intronic
1140911053 16:79453251-79453273 TGGCAGGGGAGAGATGGGATTGG - Intergenic
1144103508 17:11964807-11964829 TGGAAGGGGCAAAATGGGGTTGG + Intronic
1145959141 17:28876272-28876294 TGGCTGGGCAGAAATGGCTTGGG + Intergenic
1149086882 17:52728597-52728619 TTGCAGAGCAAATATGGAATGGG - Intergenic
1149595696 17:57863287-57863309 TGGTAGGGGAAAAAAGGGATGGG + Intronic
1149853656 17:60058697-60058719 TGAGATGGCAAAAATGGGAGTGG + Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150120726 17:62599513-62599535 TGGGAAGGCAGAAATGGGAGGGG + Intronic
1150929856 17:69573019-69573041 GGGAAGGGAAAAAAGGGGATAGG - Intergenic
1153102039 18:1483268-1483290 TGGCAGAGCAAACATAAGATGGG + Intergenic
1159142307 18:64412325-64412347 TTGCAGTCCATAAATGGGATGGG - Intergenic
1160442248 18:78901791-78901813 TGGAGGGGCAAGAATGTGATGGG - Intergenic
1161270808 19:3388222-3388244 TGGCAGGAGAAACATGGGAGGGG + Intronic
1161534731 19:4811987-4812009 GGGGAGGGCGAAAAGGGGATGGG - Intergenic
1162332854 19:10041071-10041093 TGGCTGTGCAAAATTGGGAGGGG - Intergenic
1164060893 19:21672733-21672755 TGTCAGGGTAACAATGGGACAGG - Intergenic
1164606873 19:29605966-29605988 TGGGAGGGCGGAAATGGGACGGG - Exonic
1164925078 19:32124176-32124198 TGGAGGGGCAAGAATGGGAAGGG + Intergenic
1166278496 19:41773364-41773386 TAACAGGGCAGAATTGGGATGGG - Intergenic
1166398272 19:42458398-42458420 TAGCAGGGCAGAATTGGGACTGG + Intergenic
1167105230 19:47426530-47426552 TAGAAGGGCAAAGATGGGACAGG - Intergenic
925006180 2:444782-444804 AGGCAGGGCACACATGGAATGGG - Intergenic
929426106 2:41846167-41846189 TGGCAGGGCAGAAATGTAAAAGG + Intergenic
929691914 2:44082055-44082077 TTGAAGGGGAAAAATTGGATTGG - Intergenic
930818933 2:55626206-55626228 TGGAAGAGCAGAAATGGGATTGG + Intergenic
930918158 2:56719648-56719670 TGTCAGGGTAACAATGGGACAGG + Intergenic
932132928 2:69203958-69203980 TGGAAGGGAAAAAATGAGGTCGG - Intronic
933483982 2:82895603-82895625 TGGCAGGGACAACATGGGAACGG - Intergenic
936760484 2:115773939-115773961 TACCAGGGCAAATATGGTATGGG - Intronic
937611149 2:123863220-123863242 AGGCAGGGCAAAGAGGGGAATGG + Intergenic
940097647 2:149995820-149995842 TGGAAGTGAAAAAATGGCATTGG - Intergenic
942070770 2:172313442-172313464 TGGCAGGACAGAAATGGAATGGG + Intergenic
943115885 2:183669582-183669604 TGGCAAGGCAGAGATGGGAATGG + Intergenic
943133278 2:183883227-183883249 GGGCAGGGCAGATAGGGGATTGG - Intergenic
945608134 2:211962601-211962623 TTGCAGGGTAAAAATGGAGTAGG + Intronic
947339034 2:229117660-229117682 TGGAAGGGCATAAAGGGGATAGG - Intronic
948835729 2:240625153-240625175 TGACAGGGCAGAAGTGGGCTGGG + Intronic
1168893446 20:1308606-1308628 TGGGAGGGCAAAGATGGGGCGGG + Exonic
1169693433 20:8359118-8359140 TGTCAGACCAAAAGTGGGATGGG - Intronic
1169921412 20:10737997-10738019 TGACAAGGCAAAAAGGAGATGGG - Intergenic
1170394919 20:15915738-15915760 AGGCAGGGAAAATAGGGGATGGG + Intronic
1177797105 21:25790347-25790369 GGGCAAGGCTAAAATGGGAATGG + Intergenic
1179273875 21:39873013-39873035 TGTCAGGGAAAATATGGGAACGG + Intronic
1182153379 22:28047276-28047298 TGGCAGGGCAGAAGCAGGATGGG - Intronic
1182280330 22:29214655-29214677 TGGCAGGGGAAAGATGGAAGCGG - Intronic
1182676788 22:32045250-32045272 TGGCAGGGCTAAAATGAGATTGG - Intronic
949483794 3:4518496-4518518 TAGCAGTGTAAAAATGGGGTTGG + Intronic
950632242 3:14290185-14290207 TGGCAGGGCATGAGTGGGACTGG - Intergenic
950878209 3:16298104-16298126 TTGCAGGGTAAAAATGTGACAGG - Intronic
953252815 3:41262072-41262094 AGGCAGAGCAACAATGGGGTGGG - Intronic
954987474 3:54808462-54808484 TAGCAGGGGAAAAGTGGGAGAGG + Intronic
955028180 3:55190398-55190420 GGACAGGGCAAGAAAGGGATCGG - Intergenic
955289875 3:57681840-57681862 TGCCAGGGAAAAAGTGGAATGGG + Intronic
955320390 3:57970164-57970186 AGGCAGGGTAAGAATGGAATTGG + Intergenic
956042636 3:65161196-65161218 TGGAAGGGAAAAAATAGGTTTGG - Intergenic
959555571 3:107713264-107713286 TGTCCAGGCAAAAAAGGGATAGG - Intronic
959923898 3:111900322-111900344 AGGCATGCCAAAAATGAGATAGG - Intronic
960422821 3:117468789-117468811 TAACAGGGCAAAGATGGGAGAGG - Intergenic
962788243 3:138787552-138787574 TGAAAGGGAAAAAATGTGATGGG - Intronic
966003810 3:174983350-174983372 TGGCAGGGGAAATATTGGCTTGG + Intronic
966912283 3:184566235-184566257 TGGCAGGGCCACAGTGGGGTGGG + Intronic
969243266 4:5916014-5916036 TGCCTGGGCAAAAATGGCACAGG + Intronic
969681789 4:8647136-8647158 AGGCAGGGAAAACATGGGAACGG + Intergenic
971682941 4:29724780-29724802 TGGCTGGGCAGAAATGGTTTAGG - Intergenic
974248025 4:59347701-59347723 TGACACAGCAAAAATGTGATAGG - Intergenic
976059738 4:81113127-81113149 TGGCTGGGCAAAAATGGATGAGG + Intronic
976565940 4:86550893-86550915 TGGCAGGGGAAGAATAGGCTGGG + Intronic
976722909 4:88187152-88187174 TGGCAGGGGAGAAGTGGGGTTGG + Intronic
982017935 4:151174445-151174467 GGGAAGGGAAAATATGGGATGGG - Intronic
983733163 4:171023376-171023398 AGGGAGGTCAAAAATGTGATGGG + Intergenic
984956514 4:185051039-185051061 TGTCAGGGTAACAATGGGACAGG - Intergenic
987984400 5:25127433-25127455 TGGAAGGGCAGAAAATGGATGGG + Intergenic
989056552 5:37371251-37371273 TGGCAGGGTAAAATTAGGGTAGG + Intergenic
989699719 5:44248514-44248536 TGGGAGACCAAAAATGTGATGGG + Intergenic
990762695 5:59147942-59147964 TGGCAGGCCTAATATGGTATAGG - Intronic
992882378 5:81123284-81123306 TGTCAGGTCAAAAATCAGATTGG - Intronic
994906805 5:105850588-105850610 TGGAAAGGAAAAAATGGGAAGGG + Intergenic
995683807 5:114749068-114749090 TGGTAGGGCAAAAGGGGGCTAGG - Intergenic
995840925 5:116442435-116442457 TGGCAGGGCAAGTCTGGGAAAGG - Intergenic
996283340 5:121759005-121759027 TGGCAGGGGTAAAAGGGGAATGG - Intergenic
997155929 5:131557536-131557558 AGGCAGGGGAAAAAAGAGATTGG - Intronic
997184274 5:131866162-131866184 TGGCATGGCTACAATGGGTTGGG + Intronic
998600952 5:143584385-143584407 TGGCAGGGGAAGGATGGGAGGGG - Intergenic
999585288 5:153082951-153082973 AGGGAGGGAAAGAATGGGATGGG - Intergenic
1002136809 5:177112792-177112814 TGACAAGGCAAAAGTGGGTTTGG + Intergenic
1002336457 5:178482439-178482461 GGGCGGGGCAAAGAGGGGATTGG + Intronic
1002371441 5:178758158-178758180 AGGCAGGGAAAAAAGAGGATGGG + Intergenic
1004338415 6:14785100-14785122 TGGCAGGGTTACAATGGGAGAGG - Intergenic
1004460853 6:15834477-15834499 TGGCAAGGAAGAAATGGGAATGG + Intergenic
1005385555 6:25280665-25280687 TGGCAGAGCTGAAATAGGATGGG + Intronic
1005858307 6:29881159-29881181 TGTCAGGGTAACAATGGGACAGG - Intergenic
1006358925 6:33576806-33576828 TGGCAGGGGGAAAATGGCACAGG + Intronic
1006580612 6:35075102-35075124 TGCCAGGGCAAAAATAAGGTTGG + Intronic
1006734871 6:36266442-36266464 TGTCAGGAAGAAAATGGGATGGG + Intronic
1008093561 6:47316104-47316126 TGTCAGGGTAACAATGGGACAGG - Intergenic
1008334135 6:50279793-50279815 GGGCAGGCCAAAGATGAGATGGG + Intergenic
1008477829 6:51951452-51951474 AGGCTGGTCAAAAATGAGATTGG - Intronic
1009726531 6:67542843-67542865 TAGGAGGGAAAAAATGGAATTGG + Intergenic
1010291958 6:74147749-74147771 AGGCAAGGAAAAAGTGGGATTGG - Intergenic
1012380106 6:98610644-98610666 TGGTAGGAGAAAAATGGGAGTGG + Intergenic
1012582332 6:100883924-100883946 TGGCAGTCACAAAATGGGATTGG + Intergenic
1013227010 6:108126886-108126908 TGGCAGTCCAAAAAAGGGCTGGG - Intronic
1013588570 6:111601118-111601140 TGGGAGGGAAGAAAGGGGATGGG + Intronic
1019215670 6:170441697-170441719 TGGGAGTGCAAAAATGAGAAAGG + Intergenic
1022634147 7:32115958-32115980 TGGCAGGGAAAAAATGGCATGGG + Intronic
1024102279 7:46044503-46044525 TGTCAGGGTAACAATGGGACAGG - Intergenic
1024681785 7:51697790-51697812 TGGCAGGGAAAAATTAGGACAGG - Intergenic
1024862065 7:53856182-53856204 TGGGCTGGCAAAAATGAGATGGG - Intergenic
1025745568 7:64239709-64239731 GGGCAGGGCACAAATAAGATAGG - Intronic
1028504864 7:91559671-91559693 TGGCAGAGGAAAAGTGAGATCGG + Intergenic
1032920556 7:136541132-136541154 TGGTAGGGAAAAGATGGGAAGGG - Intergenic
1034272670 7:149811023-149811045 TCACAGGGCCATAATGGGATGGG - Intergenic
1037459481 8:19094581-19094603 TGGCAGGGTATGAGTGGGATAGG + Intergenic
1037740267 8:21603238-21603260 TGGCTGGTGACAAATGGGATGGG + Intergenic
1037942575 8:22963719-22963741 TGGCAGGCAAAAAATGAGAGAGG + Intronic
1039270958 8:35879793-35879815 TGGAAGGGCAAACATGGTTTAGG - Intergenic
1039727136 8:40230592-40230614 TGGCAGAGGAAAAGTAGGATTGG + Intergenic
1043055186 8:75428885-75428907 TGGCAGGTGAAAAATGGATTGGG + Intronic
1044802810 8:95974686-95974708 TGGCAGGGCAAAAGTCAGAGAGG - Intergenic
1045346751 8:101300444-101300466 TGCCAGAGCAGAAATGGGAGAGG + Intergenic
1045834352 8:106502936-106502958 TGGCAAGGCAAAATTGAAATTGG + Intronic
1047578083 8:126180491-126180513 TTGCAGGATAAAAGTGGGATAGG - Intergenic
1049585021 8:143429022-143429044 TGGCAGGGCGAAGGTGGGAACGG + Exonic
1050144347 9:2550121-2550143 TGGGATGGCATAGATGGGATGGG - Intergenic
1050710112 9:8451807-8451829 TGGCAGAGCCACAATGGGAAGGG - Intronic
1055781562 9:79826888-79826910 TGGCAGGGAAAAAATACAATGGG + Intergenic
1056216129 9:84407905-84407927 TGGAAGGGCAAAAAAGGAACTGG + Intergenic
1056646823 9:88420021-88420043 TGGCAGAACAAAAAGCGGATTGG - Intronic
1060043429 9:120321491-120321513 TTGCAGGGAAAAATTCGGATGGG + Intergenic
1060964652 9:127705876-127705898 TGGGAGGGCACAAATGTGACTGG - Intronic
1061568159 9:131458065-131458087 TGGCTGGACAAGAAGGGGATGGG - Intronic
1190318458 X:49165698-49165720 TAGCCGGGGGAAAATGGGATGGG + Intronic
1190528431 X:51351115-51351137 TGGAAGTGCAAAAAAGGGATGGG - Intergenic
1192601536 X:72469553-72469575 TGACAAGGCAAAAATGGCAAAGG - Intronic
1193405608 X:81097471-81097493 AAGCAGGCCAAAATTGGGATGGG + Intergenic
1195031248 X:100929351-100929373 TGGCGGGACAAAAAGGGGCTTGG + Intronic
1197050028 X:122046598-122046620 TGGCAGGGCAAAATTAGGTGGGG + Intergenic
1197723220 X:129759077-129759099 TGGCAGGGCTGGGATGGGATGGG - Intronic
1198238126 X:134756175-134756197 TTGCATGGCAAAAATCAGATAGG - Intronic
1198891021 X:141396389-141396411 GGGCAGGACAAAAATGGGTGTGG - Intergenic
1200054270 X:153450561-153450583 TGTCAGTGCAAGAATGGGACAGG - Intronic
1200107477 X:153723290-153723312 TGGCAGGGCACAAAAGGTACGGG + Intronic
1200517926 Y:4170991-4171013 TGGAAGATAAAAAATGGGATGGG - Intergenic